View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7841_low_11 (Length: 317)
Name: NF7841_low_11
Description: NF7841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7841_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 38046731 - 38046415
Alignment:
| Q |
1 |
gactgccgtcactgaccacctttcaccattgccacccaacactctccatcatcatcgctgccaccctgcacccttcatcactatcatcctccatctctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046731 |
gactgccgtcactgaccacctttcaccattgccacccaacactctccatcatcatcgctgccaccctgcacccttcatcactatcatcctccatctctta |
38046632 |
T |
 |
| Q |
101 |
atcactcaaacacgtgatataacacacaatactatacagtggactgcctaagatacagcacatttaaaaatataagaacttatcagactcatatatatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046631 |
atcactcaaacacgtgatataacacacaatactatacagtggactgcctaagatacagcacatttaaaaatataagaacttatcagactcatatatatcc |
38046532 |
T |
 |
| Q |
201 |
tctttaattcttatccaactctcttaatctatttgtccttattttatcatgtcctcgtacgagtcctaaatagtaaattcaatcaatcaacaaatgattt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046531 |
tctttaattcttatccaactctcttaatctatttgtccttattttatcatgtcgtcgtacgagtcctaaatagtaaattcaatcaatcaacaaatgattt |
38046432 |
T |
 |
| Q |
301 |
ccaacctcatcttgttt |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38046431 |
ccaacctcatcttgttt |
38046415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University