View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7841_low_12 (Length: 312)
Name: NF7841_low_12
Description: NF7841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7841_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 24766441 - 24766732
Alignment:
| Q |
1 |
acttttgtttcataagtattatttccagtcccttttgtatcagatattttgaatctttttgttgaaacaacattgctgtgtttaattaaattgctctata |
100 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24766441 |
acttttgtttcataagtattatttctaatcccttttgtatcagatattttgaatctttttgttgaaacaacattgctgcgtttaattaaattgctctata |
24766540 |
T |
 |
| Q |
101 |
nnnnnnngcatttgtaattagccatgactgcgatttattgttgttatttcagtcnnnnnnngaatacaatgcagtgc--gtgtgtgtatttactccactt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24766541 |
tttttttgcatttgtaattagccatcactgcgatttattgttgttatttcagtcaaaaaaagaatacaatgcagtgcgtgtgtgtgtatttactccactt |
24766640 |
T |
 |
| Q |
199 |
taagtgcattcttttagaaaataatataatggaccggcttcctgcattcttttatattaagaccattcttttagaatatcaatcatcctcatttttt |
295 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||| ||||||||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
24766641 |
taagtgcattcttttaggaa-----ataatggaacggcttcatgcattcttttgtattaagaccattcttttagaatatctaccatcctcatttttt |
24766732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University