View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7841_low_22 (Length: 256)
Name: NF7841_low_22
Description: NF7841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7841_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 9659337 - 9659563
Alignment:
| Q |
13 |
aatatagacataagcaacaacataaaccgaaggtccagcacgtgtgtatctaaaaattctctctaaataagattgaatggttaaatcaggaatctctcta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659337 |
aatatagacataagcaacaacataaaccgaaggtccagcacgtgtgtatctaaaaattctctctaaataagattgaatggttaaatcaggaatctctcta |
9659436 |
T |
 |
| Q |
113 |
caatcaaatatttttgtgcttgctttggacaaaactctagaagaacaattcttcacaattctttgtgctcttgccatgttcctctcaattaatgaagcta |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659437 |
caatcaaagatttttgtgcttgctttggacaaaactcttgaagaacaattcttcactattctttgtgctcttgccatgttcctctcaattaatgaagcta |
9659536 |
T |
 |
| Q |
213 |
gaacatttatcactaatggggtgtttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9659537 |
gaacatttatcactaatggggtgtttg |
9659563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University