View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7841_low_31 (Length: 201)
Name: NF7841_low_31
Description: NF7841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7841_low_31 |
 | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 43 - 185
Target Start/End: Original strand, 410207 - 410349
Alignment:
| Q |
43 |
attgtgaatccagatcgtgaaccaccgagaagagaatcagtaaacaccctaactcgttcttggcgttatttttcacgaacacgaaatggaagacacatta |
142 |
Q |
| |
|
||||| |||||| || ||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410207 |
attgttaatccatattgtgaaccaccgggaagagaatcagtaaacatcctaactcgttcatggcgttatttttcacgaacacgaaatggaagacacatta |
410306 |
T |
|
| Q |
143 |
ccaaaaccagatcgcatctgaataagagatatatagaagaata |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410307 |
ccaaaaccagatcgcatctgaataagagatatatagaagaata |
410349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 50
Target Start/End: Original strand, 410190 - 410227
Alignment:
| Q |
13 |
tttatgaacaaaatcagattgttaatccatattgtgaa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410190 |
tttatgaacaaaatcagattgttaatccatattgtgaa |
410227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 156
Target Start/End: Original strand, 26355048 - 26355180
Alignment:
| Q |
25 |
atcagattgttaatccatattgtgaatccagatcgtgaaccaccgagaagagaatcagtaaaca-ccctaactcgttcttggcgttatttttcacgaaca |
123 |
Q |
| |
|
||||||||||||||||||| |||| | || ||||||||||||| | || | ||||| |||| ||| ||||||||| ||| |||| | |||| |||| |
|
|
| T |
26355048 |
atcagattgttaatccataccgtgatttcatatcgtgaaccaccaggtagggcatcagctaacatccccaactcgttcatggtgttactattcatgaacg |
26355147 |
T |
|
| Q |
124 |
cgaaatggaagacacattaccaaaaccagatcg |
156 |
Q |
| |
|
|||||||||||| |||||||||||| |||| |
|
|
| T |
26355148 |
tgaaatggaagacgtgttaccaaaaccaaatcg |
26355180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University