View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7842_high_7 (Length: 239)

Name: NF7842_high_7
Description: NF7842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7842_high_7
NF7842_high_7
[»] chr7 (1 HSPs)
chr7 (19-225)||(5516437-5516643)
[»] chr1 (1 HSPs)
chr1 (56-98)||(36927989-36928031)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 5516643 - 5516437
Alignment:
19 accattaatggtccggttcagnnnnnnngaactatagtaacagttcagtttggtttaattttcttcttgaaccgaaccataaacaatctaaaataccaca 118  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
5516643 accattaatggtccggttcagtttttttgaactatagtaacagttcagtttggtttagttttcttcttgaaccgaaccataaacaatctaaaataccaca 5516544  T
119 attgttaccacaggtcaggaatggaacaaaaacgagtttgagggagataaaatcaaagctaaatttgctcaaaaggtatatatttattggcttcaggtct 218  Q
     ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
5516543 gttgttactacaggtcaggaatggaacaaaaacgagtttgagggagataaaatcaaagcgaaatttgctcaaaaggtatatatttattggcttcaggtct 5516444  T
219 acttcat 225  Q
    |||||||    
5516443 acttcat 5516437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 36928031 - 36927989
Alignment:
56 taacagttcagtttggtttaattttcttcttgaaccgaaccat 98  Q
    |||||||||||||||||||||||||| |||  |||||||||||    
36928031 taacagttcagtttggtttaattttcatctcaaaccgaaccat 36927989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University