View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7842_high_8 (Length: 223)
Name: NF7842_high_8
Description: NF7842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7842_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 12 - 180
Target Start/End: Complemental strand, 45933470 - 45933302
Alignment:
| Q |
12 |
ataatattaatgacttcaatttggttaagttaaattagtagaagtataagtactattattctctctttttctaacttgtgttaaaatatcaataatctct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45933470 |
ataatattaatgacttcaatttggttaagttaaattagtagaagtataagtactattattctctctttttctaatttgtgttaaaatatcaataatctct |
45933371 |
T |
 |
| Q |
112 |
cttcnnnnnnnacatgtacttgtactataatttttgtgtgaatggaatctacatgtgtgatgaagaagg |
180 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45933370 |
cttctttttttacatgtacttgtactataatttttgtgtgaatggaatctacatgtgtgatgaagaagg |
45933302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University