View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7842_low_8 (Length: 280)
Name: NF7842_low_8
Description: NF7842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7842_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 41 - 267
Target Start/End: Original strand, 3685263 - 3685489
Alignment:
| Q |
41 |
tcgtttgtgaaattcattgtatacaaaggtttaacacgtgaaagacgtacaaggctaggcatggcatacgcatgcccttagccacgtgaggttgacgata |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3685263 |
tcgtttgtgaaattcattgtatacaaaggtttaacacgtgaaagacgtacacggctaggcatggcatacgcatgcccttagccacatgaggttgacgata |
3685362 |
T |
 |
| Q |
141 |
cagtaccgtcacaacattagcaattctcgtttgctctcgggccttaacgacttttaattcaatctcatttgtggttcaatcaaaataacacaggctgcgt |
240 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685363 |
cagtaccgtcacaacattagcaatttttgtttgctctcgggccttaacgacttttaattcaatctcatttgtggttcaatcaaaataacacaggctgcgt |
3685462 |
T |
 |
| Q |
241 |
acgataaaggagtagagtcttgcaaat |
267 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3685463 |
acgataaaggagtagagtcttgcaaat |
3685489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University