View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7842_low_9 (Length: 250)
Name: NF7842_low_9
Description: NF7842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7842_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 4 - 240
Target Start/End: Original strand, 9233713 - 9233947
Alignment:
| Q |
4 |
cgaaaccaaacatatgcatataaatgtaccaattttaaagcacatactctaatttatttcaaaactaaataaattataggtttaatcggtttgctaatga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9233713 |
cgaaaccaaacatatgcatataaatgtaccaattttaaagcacatactctaatttatttcaaaactaaataaattttaggtttaatcggtttgctaatga |
9233812 |
T |
 |
| Q |
104 |
tatattggttcaatactcataatgatcagatgattgattttgagttttatagaacactattcttggttagctaagagacttgttccactgtcatttgatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9233813 |
tatattggttcaatactcataatgatcagatgattgattttgagttt--tagaacactattcttggttagctaagagacttgttccactgtcatttgatt |
9233910 |
T |
 |
| Q |
204 |
cttggttaccaacggttgcccatctattaactctctg |
240 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9233911 |
cttggttatcaacggttgcccatctattaactctctg |
9233947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 9214181 - 9214235
Alignment:
| Q |
153 |
tagaacactattcttggttagctaagagacttgttccactgtcatttgattcttg |
207 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
9214181 |
tagaaccctattcttgattagccaagagacttgttccactgccatttgattcttg |
9214235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University