View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7843_low_1 (Length: 480)
Name: NF7843_low_1
Description: NF7843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7843_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 78 - 465
Target Start/End: Complemental strand, 14470046 - 14469659
Alignment:
| Q |
78 |
acaatacatgtatatttctactattttgttatggccttgaaggtagtaaaataccacaactctggtctttctgatttcttggctacatggttaagtaccg |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||| |||||||||||| |||||||| |||||| | ||||| | |||||||||||||||| |
|
|
| T |
14470046 |
acaatacatgcatatttctactattttgttctggccttgaaggcagtaaaataccaaaactctggcatttctgttatcttgac-acatggttaagtaccg |
14469948 |
T |
|
| Q |
178 |
actttgctttttcttggattctacgaaaacacgtttggtgtagcaagtatctaaggaaatcaatgtgatcatcaagagcggcagaa-ccgtcgtagcgct |
276 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||| || |||||| |||||||| ||||||||| | || |||| ||||||||||||| |
|
|
| T |
14469947 |
actttgctttttcttggattctacggaaacatgtttggtgtagcaagcatttaaggagatcaatgtcatcatcaagggaggaagaaaccgtcgtagcgct |
14469848 |
T |
|
| Q |
277 |
taacacttatcagcatctggagttcctttggtacatgataatcatttattttgctcgtaaaaacattctttaccgcctggtcaaatatttactgctcat- |
375 |
Q |
| |
|
||||||| | |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||| | |||||| |||||||| |||| |
|
|
| T |
14469847 |
taacactaagcagcatctggagttccgttggtacatgataatcatttatttttctcgtaaaaaaattctttacc--caggtcaaccatttactgttcata |
14469750 |
T |
|
| Q |
376 |
-tatccaaggattcttggattgttgattttggtcctagttcacaacttcacatatggcattcctcaattatttcttgtatctcaagatgtt |
465 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14469749 |
atatccatggattcttggattgttgattttggttctagttcacaacttcacatatgacattcctcaactatttctagtatctcaagatgtt |
14469659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University