View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7843_low_14 (Length: 233)
Name: NF7843_low_14
Description: NF7843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7843_low_14 |
 |  |
|
| [»] scaffold0189 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 30465 - 30550
Alignment:
| Q |
1 |
cttccgagacatgctaggttacagaggatgacttatgcttccaaagttaaagttgatgttcaacttcaggttactcattttataaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30465 |
cttccgagacatgctaggttacagaggatgacttatgcttccaaagttaaagttgatgttcaacttcaggttactcattttataaa |
30550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 30636 - 30697
Alignment:
| Q |
172 |
acttgaaaattacttgggtgtcttttggtttttgtgtgtaaatagtagtagagctggaaata |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30636 |
acttgaaaattacttgggtgtcttttggtttttgtgtttaaatagtagtagagctggaaata |
30697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 48883223 - 48883162
Alignment:
| Q |
1 |
cttccgagacatgctaggttacagaggatgacttatgcttccaaagttaaagttgatgttca |
62 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
48883223 |
cttcccagacatgccaggttgcagaggatgacttatgcttctaagatgaaagttgatgttca |
48883162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 53014544 - 53014493
Alignment:
| Q |
22 |
cagaggatgacttatgcttccaaagttaaagttgatgttcaacttcaggtta |
73 |
Q |
| |
|
||||||||||| |||||||||||| | ||| ||||||||||| ||||||||| |
|
|
| T |
53014544 |
cagaggatgacctatgcttccaaaatcaaaattgatgttcaagttcaggtta |
53014493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University