View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7843_low_15 (Length: 229)
Name: NF7843_low_15
Description: NF7843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7843_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 13894549 - 13894351
Alignment:
| Q |
23 |
acactctaccttggggtggctagcccttgaggcggatcccgcaatgggtgcatgacttttgttttacttgagagtagaagccttggcatccgctctccac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13894549 |
acactctaccttggggtggctagcccttgaggcggatcccgcaatgggtgcatgacttttgttttacttgagagtagaagccttgacatccgctctccac |
13894450 |
T |
 |
| Q |
123 |
gagggtgattcccttgcttgcggcattgagtcctgttaatcatgaaacaaagaagcaatcacaagatctcaaggctatgatggccgatatgatgtccat |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13894449 |
gagggtgcttcccttgcttgcggcattgagtcctgttaatcatgaaacaaagaagcaatcacaagatctcaaggctatgatggcagatatgatgtccat |
13894351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 175
Target Start/End: Original strand, 18801884 - 18802037
Alignment:
| Q |
23 |
acactctaccttggggtggctagcccttgaggcggatcccgcaatgggtgcatgac--ttttgttttacttgagagtagaagccttggcatccgctctcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||| |||||| | ||||| | | | ||||||| |||||||||||||| ||||||| ||| | |||| |
|
|
| T |
18801884 |
acactctaccttggggtggctagcccctgagacgggtcccgcgacgggtgtaaggcctttttgttctacttgagagtagagaccttggcttccaccctcc |
18801983 |
T |
 |
| Q |
121 |
acgagggtgattcccttgcttgcggcattgagtcctgttaatcatgaaacaaaga |
175 |
Q |
| |
|
|||| || | | || |||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
18801984 |
-ggaggttgctactctcgcttgcggaattgagtcctgaaaatcacaaaacaaaga |
18802037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 54
Target Start/End: Complemental strand, 17715068 - 17715037
Alignment:
| Q |
23 |
acactctaccttggggtggctagcccttgagg |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17715068 |
acactctaccttggggtggctagcccttgagg |
17715037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University