View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7843_low_4 (Length: 396)
Name: NF7843_low_4
Description: NF7843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7843_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 29 - 378
Target Start/End: Complemental strand, 49085613 - 49085273
Alignment:
| Q |
29 |
aaacaaagatggattattataatcaaaattgagtaaataaacgaaccttggagacatctcgattaagctttctgacagtgtttgaaagcgaagcattctc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085613 |
aaacaaagatggattattataatcaaaattgagtaaataaacggaccttggagacatctcgattaagctttctgacagtgtttgaaagcgaagcattctc |
49085514 |
T |
|
| Q |
129 |
cttaagcaaattctcctaaaatatcaacctcaagtcaactcaaccaccgaaaacaaatactgnnnnnnnntatgaaacagaaagagtatgggaaattaaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
49085513 |
cttaagcaaattctcctaaaatatcaacctcaactcaactcaact--------caaccactgaaaaaaa-tatgaaacagaaagagtatgggaaattaaa |
49085423 |
T |
|
| Q |
229 |
ccttatcttgctctgcacggacgagattgtcggcggtttgagagagggaaacgtcgagagactcaagctgagactgaagttccgctatgagttcatcttt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085422 |
ccttatcttgctctgcacggacgagattgtcggcggtttgagagagggaaacgtcgagagactcaagctgagactgaagttccgctatgagttcatcttt |
49085323 |
T |
|
| Q |
329 |
ctcggcgatcttggcccgaagttccgatgactccaattcaagggctttga |
378 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49085322 |
ctcggcggtcttggcgcgaagttccgatgactccaattcaagggctttga |
49085273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University