View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7844_high_10 (Length: 270)
Name: NF7844_high_10
Description: NF7844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7844_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 16425331 - 16425087
Alignment:
| Q |
18 |
atccatctgtatagtcaaataaggttatttacttattacggtcaatttgatttggaattttcatcacaaattacatgcatgttggtcctgctatgtaaaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16425331 |
atccatctctatagtcaaataaggttatttacttattacggtcaatttgatttggaattttcatcacaaattacatgcatgttggtcctgctatgtaaaa |
16425232 |
T |
 |
| Q |
118 |
gaaataacttaaatcgatagggtcaaattcactcatgtaggtcctcattgcagcgaaattcattctcaaggttttgctatcaacacaaaaatctgaaaaa |
217 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16425231 |
gaaataacttacatcggtagggtcaaattcactcatgtaggtcctcattacagcaaaattcattctcaaggatttgctatcaacacaaaaatctgaaaaa |
16425132 |
T |
 |
| Q |
218 |
tacaataaaactaacgttaggatcaaccaaaatgccatacatata |
262 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16425131 |
tacaataaaactaacattaggatcaaccaaaatgccatacatata |
16425087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University