View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7844_high_12 (Length: 224)

Name: NF7844_high_12
Description: NF7844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7844_high_12
NF7844_high_12
[»] chr1 (1 HSPs)
chr1 (15-206)||(45155045-45155236)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 45155236 - 45155045
Alignment:
15 agagattgaatttcgggttgaagtttggtttgggtcaggatctgagtaaccgtgggttgatctggatccaagagatgctctgcaaataaacggtaagagg 114  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45155236 agagattgaatttcgggttgaagtttggtttgggttaggatctgagtaaccgtgggttgatctggatccaagagatgctctgcaaataaacggtaagagg 45155137  T
115 gaagtcgggttgatgtggtggactcttctcttgataaacaagaacgacgttgtggaccattggaatatgaaaccacgcgtgtccaaaactct 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45155136 gaagtcgggttgatgtggtggactcttctcttgataaacaagaacgacgttgtggaccattggaatatgaaaccacgcgtgtccaaaactct 45155045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University