View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7844_low_13 (Length: 224)
Name: NF7844_low_13
Description: NF7844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7844_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 45155236 - 45155045
Alignment:
| Q |
15 |
agagattgaatttcgggttgaagtttggtttgggtcaggatctgagtaaccgtgggttgatctggatccaagagatgctctgcaaataaacggtaagagg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45155236 |
agagattgaatttcgggttgaagtttggtttgggttaggatctgagtaaccgtgggttgatctggatccaagagatgctctgcaaataaacggtaagagg |
45155137 |
T |
 |
| Q |
115 |
gaagtcgggttgatgtggtggactcttctcttgataaacaagaacgacgttgtggaccattggaatatgaaaccacgcgtgtccaaaactct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45155136 |
gaagtcgggttgatgtggtggactcttctcttgataaacaagaacgacgttgtggaccattggaatatgaaaccacgcgtgtccaaaactct |
45155045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University