View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7845_high_3 (Length: 236)
Name: NF7845_high_3
Description: NF7845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7845_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 10585027 - 10584824
Alignment:
| Q |
18 |
attaatatgtccggcctcaacaaaaggttttccaaagttgtagaggtgcctccaaaa--caccaattagagtattaaccaaagttttctttattgtcaac |
115 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10585027 |
attaatatgtctggcctcgacaaaaggttttccaaagttgtagaggtggctccaaaaaacaccaattagagtattaaccaaagttttctttactgtcaac |
10584928 |
T |
 |
| Q |
116 |
ccaatttgttagttgagaaaaagaattaattttcattacggggttcttttgttacatgaggtgggcatatcacctgttcttgttttacatttggagcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584927 |
ccaatttgttagttgagaaaaagaattaattttcattacggggttcttttgtaacatgaggtgggcatatcacctgttcttgttttacatttggagcttc |
10584828 |
T |
 |
| Q |
216 |
ctct |
219 |
Q |
| |
|
|||| |
|
|
| T |
10584827 |
ctct |
10584824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University