View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7847_high_1 (Length: 353)
Name: NF7847_high_1
Description: NF7847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7847_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 175 - 336
Target Start/End: Original strand, 25981036 - 25981197
Alignment:
| Q |
175 |
gaaaatggaaaaagaggaacatggcggatcattgatggattgggagggaacatgaccggaatacattccaaaaagagacgtcatctcaaatgttctttcc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
25981036 |
gaaaatggaaaaagaggaacatggcggatcattgatggattgggagggaacatgaccggaatacattccaaaaagagacgtcatctcaaatggtccttcc |
25981135 |
T |
 |
| Q |
275 |
atgggggtaacaggggagcgagattcttggtggagaagggtaacatgagagacaaacccatt |
336 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25981136 |
atggggataactggggagcgagattctgggtggagaagggtaacatgagagacaaacccatt |
25981197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University