View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7848_high_6 (Length: 289)
Name: NF7848_high_6
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7848_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 284
Target Start/End: Complemental strand, 37124770 - 37124496
Alignment:
| Q |
14 |
acaaacatcgtcttccattcttcgcgtatttgcttgcttatacatctctctcaggtaatctaatctaaattctcaataatcctcacttattgtcgttgca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37124770 |
acaaacatcgtcttccattcttcgcgtatttgcttgcttatacatctctctcaggtaatctaatctaaattctcaataatcctcacttattgttgttgca |
37124671 |
T |
 |
| Q |
114 |
atannnnnnnn---cgatcacatgttcgtttattcctttgactgaatatattttttattgatgatcatagtagaattgccaacccagtagatat-aaaag |
209 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
37124670 |
atatttttttttttcgatcacatgttcgtttattcctttgactgaatatattttttattgatgatcatagtagaattgccaacacagtagatataaaaag |
37124571 |
T |
 |
| Q |
210 |
gttccctgaagaactcaaacttaaacaaacatgatcttgataatttacgatcctgtgtgttatctttatcgcttc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37124570 |
gttccctgaagaactcaaacttaaacaaacatgatcttgatgatttacgatcctgtgtgttatctttatcgcttc |
37124496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University