View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7848_high_7 (Length: 210)
Name: NF7848_high_7
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7848_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 30 - 171
Target Start/End: Original strand, 7244842 - 7244983
Alignment:
| Q |
30 |
caaagtggagtgatagctctcaagctgaatggattgatcaaaatcggaacgatgactttcaagctgaatggattggctgtgggacgggatcctaccttta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |||||||||||||| | |
|
|
| T |
7244842 |
caaagtggagtgatagctctcaagctgaatggattgatcaaaatcggaacgatgactttctagctaaatggattgactgtggggcgggatcctaccttca |
7244941 |
T |
 |
| Q |
130 |
caatcttatggcctacatgccgtttaattaatgaattcttag |
171 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
7244942 |
caatcttatggcctagatgccgtttaattaaagaattcttag |
7244983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 64 - 166
Target Start/End: Complemental strand, 7323357 - 7323254
Alignment:
| Q |
64 |
tgatcaaaatcggaacgatgactttcaagctgaatggattggctgtgggacgggatcctacctttacaatcttatggcct-acatgccgtttaattaatg |
162 |
Q |
| |
|
||||||| | ||||| || ||||||| |||||| ||||||| ||| |||||||||||||||||| ||||||| ||||||| | |||||||||||| ||| |
|
|
| T |
7323357 |
tgatcaagaccggaatgacgactttctagctgagtggattgactgcgggacgggatcctaccttcacaatctcatggcctaatatgccgtttaatctatg |
7323258 |
T |
 |
| Q |
163 |
aatt |
166 |
Q |
| |
|
|||| |
|
|
| T |
7323257 |
aatt |
7323254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University