View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7848_low_1 (Length: 607)
Name: NF7848_low_1
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7848_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 535
Target Start/End: Original strand, 2030654 - 2030689
Alignment:
| Q |
500 |
caggaaatgcagattgacagaaacctagccaattca |
535 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2030654 |
caggaaatgcagattgacagaaacctagccaattca |
2030689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 463 - 544
Target Start/End: Original strand, 23341860 - 23341941
Alignment:
| Q |
463 |
ccaaggtaatcaatgacagttatctcggttggctcggcaggaaatgcagattgacagaaacctagccaattcagcttctgaa |
544 |
Q |
| |
|
|||||||||||||| | |||||||| |||| ||| ||||||| | |||||| || || |||||||||||||||||||||| |
|
|
| T |
23341860 |
ccaaggtaatcaataagcgttatctccgttgactcagcaggaagggtagattggcaaaatcctagccaattcagcttctgaa |
23341941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University