View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7848_low_11 (Length: 238)
Name: NF7848_low_11
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7848_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 27 - 222
Target Start/End: Original strand, 41219072 - 41219267
Alignment:
| Q |
27 |
aattaaagtaatggtttattctatttggtatcacatagtatgatgaaaaggtaaattgttgtaaacgatggaattagatgaatatgtcatcatagcaccc |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
41219072 |
aattaaagtgctggtttattctatttggtatcacatagtatgatgaaaaggtaaattgttgtaaacaatggaattagatgaatatgtcatcatggcaccc |
41219171 |
T |
|
| Q |
127 |
ataacttgtgaaaatatccaaacaaatgtatgtcttagcattccattctattcaacttcattctattgcataccatcaatctaaacttacgttatg |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41219172 |
ataacttttgaaaatatccaaacaaatgtatgtcttagcattccattctattcaacttcattctattgcataccatcaatctaaacttacgttatg |
41219267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University