View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7848_low_12 (Length: 210)

Name: NF7848_low_12
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7848_low_12
NF7848_low_12
[»] chr4 (2 HSPs)
chr4 (30-171)||(7244842-7244983)
chr4 (64-166)||(7323254-7323357)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 30 - 171
Target Start/End: Original strand, 7244842 - 7244983
Alignment:
30 caaagtggagtgatagctctcaagctgaatggattgatcaaaatcggaacgatgactttcaagctgaatggattggctgtgggacgggatcctaccttta 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |||||||||||||| |    
7244842 caaagtggagtgatagctctcaagctgaatggattgatcaaaatcggaacgatgactttctagctaaatggattgactgtggggcgggatcctaccttca 7244941  T
130 caatcttatggcctacatgccgtttaattaatgaattcttag 171  Q
    ||||||||||||||| ||||||||||||||| ||||||||||    
7244942 caatcttatggcctagatgccgtttaattaaagaattcttag 7244983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 64 - 166
Target Start/End: Complemental strand, 7323357 - 7323254
Alignment:
64 tgatcaaaatcggaacgatgactttcaagctgaatggattggctgtgggacgggatcctacctttacaatcttatggcct-acatgccgtttaattaatg 162  Q
    ||||||| | ||||| || ||||||| |||||| ||||||| ||| |||||||||||||||||| ||||||| ||||||| | ||||||||||||  |||    
7323357 tgatcaagaccggaatgacgactttctagctgagtggattgactgcgggacgggatcctaccttcacaatctcatggcctaatatgccgtttaatctatg 7323258  T
163 aatt 166  Q
    ||||    
7323257 aatt 7323254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University