View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7848_low_3 (Length: 426)
Name: NF7848_low_3
Description: NF7848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7848_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 176 - 413
Target Start/End: Complemental strand, 29438980 - 29438747
Alignment:
| Q |
176 |
gtcctcaatttcccccaatcccttgctgtctttacaacatataggactttaggaaggagacaaggatgaaaccactccaaggtcgtggatggaaggttgc |
275 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29438980 |
gtcctcaatttcccccaatcccttactgtctttacaacatataggactttaggaaggagacaaggatgaaaccactccaaggtcgtggatggaaggttgc |
29438881 |
T |
 |
| Q |
276 |
ttgatgtcgttcagttgtatatatatccctgaaagtagattcctctgagtatgggttgttggcattacaagaatgcacaattgaagcgacacctctttat |
375 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29438880 |
ttgatgtcgttcagttgt----atatccctgaaagtagattcctctgagtatgggttgttggcattacaagaatgcacaattgaagcgacacctctttat |
29438785 |
T |
 |
| Q |
376 |
gctgattgttgatgtgtgtcctacgcatgtgtatgatg |
413 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29438784 |
gctgattgttgatgtgtgtcttacgcatgtgtatgatg |
29438747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University