View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7849_high_5 (Length: 360)
Name: NF7849_high_5
Description: NF7849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7849_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 7 - 349
Target Start/End: Original strand, 43579062 - 43579405
Alignment:
| Q |
7 |
ggaatatgcgatgaagattgggaagagggagtgggatgatgaggagataagagaagggtttgtgaggggaggaggtggatggcatggtcaagggtggctt |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43579062 |
ggaatatgcgatgaaaattgggaagagggagtgggatgatgaggagataagagaagggtttgtgaggggaggtggtggatggcatggtcaagggtggctt |
43579161 |
T |
 |
| Q |
107 |
ggaagcggggaatggaaggttgttaagacgaatgtagatgaggatggaatgtgtctttcatgcagtgagaagcttgtgagcattgatattgatccaaaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43579162 |
ggaagcggggaatggaaggttgttaagacgaatgtagatgaggatggaatgtgtctttcatgcagtgagaagcttgtgagcattgatattgatccaaaag |
43579261 |
T |
 |
| Q |
207 |
agactgaaaactttgctgcctcgttgtctaaattggctcatgaaaaacaccctaaggcaaactgcaatcattttcaggtagaacagtcttcactgctttg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43579262 |
agactgaaaactttgctgcctcgttgtctaaattggctcatgaaaaacaacctaaggcaaacttcaatcattttcaggtagaacagtcttcactgctttg |
43579361 |
T |
 |
| Q |
307 |
tccataaattatg-ttacttacttaaaaactgaatttggtgatg |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43579362 |
tccataaattatgtttacttacttaaaaactgaatttggtgatg |
43579405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University