View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7849_high_9 (Length: 232)
Name: NF7849_high_9
Description: NF7849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7849_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 15 - 120
Target Start/End: Complemental strand, 17271290 - 17271183
Alignment:
| Q |
15 |
ttattctaaataaaataa--taatgattttaaatatgcaaaaatagatgtgcaattatttcnnnnnnngtggaagatggaaaatatgtagtcaactgtgc |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17271290 |
ttattctaaataaaataaaataatgattttaaatatgcaaaaatatatgtgcaattatttctttttttgtggaagatggaaaatatgtagtcaactgtgc |
17271191 |
T |
 |
| Q |
113 |
acacgtac |
120 |
Q |
| |
|
|||||||| |
|
|
| T |
17271190 |
acacgtac |
17271183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 146 - 187
Target Start/End: Complemental strand, 17271145 - 17271104
Alignment:
| Q |
146 |
gccatttctttcacttctccatggacaccaaaccctgccaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17271145 |
gccatttctttcacttctccatggacaccaaaccctgccaag |
17271104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 146 - 187
Target Start/End: Original strand, 19854896 - 19854937
Alignment:
| Q |
146 |
gccatttctttcacttctccatggacaccaaaccctgccaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19854896 |
gccatttctttcacttctccatggacaccaaaccctgccaag |
19854937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University