View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_11 (Length: 534)
Name: NF7850A_low_11
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_11 |
 | |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold1001 (1 HSPs) |
| | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0026 (2 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
| [»] scaffold0712 (1 HSPs) |
| | |
|
| [»] scaffold0709 (1 HSPs) |
| | |
|
| [»] scaffold0065 (2 HSPs) |
| | |
|
| [»] scaffold0056 (3 HSPs) |
| | |
|
| [»] scaffold0326 (4 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
| [»] scaffold0166 (1 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0160 (2 HSPs) |
| | |
|
| [»] scaffold0123 (2 HSPs) |
| | |
|
| [»] scaffold0684 (2 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0005 (3 HSPs) |
| | |
|
| [»] scaffold0105 (1 HSPs) |
| | |
|
| [»] scaffold0001 (2 HSPs) |
| | |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
| [»] scaffold0078 (2 HSPs) |
| | |
|
| [»] scaffold0176 (1 HSPs) |
| | |
|
| [»] scaffold0011 (3 HSPs) |
| | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
| [»] scaffold0119 (1 HSPs) |
| | |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
| [»] scaffold0085 (2 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 1e-82; HSPs: 181)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 34 - 347
Target Start/End: Complemental strand, 41695299 - 41694991
Alignment:
| Q |
34 |
ttttttaggagtattttatggggcatatgagcaataaaaatgtgatcatggtggttcttgtaagggtttggattatcacagtgtctcttgatatgaattt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||| ||| |
|
|
| T |
41695299 |
ttttttaggagtattttatggggcatatgggcaataaaaatgtgatcatggtggtgcttgtaagggtttggattatcataacgtctcttgatatgacttt |
41695200 |
T |
|
| Q |
134 |
gtttggtgaatctagataatgctcacaatttgtttgtt-ttttaattgtttatttgatgagtcgaagtactcacaatttgtttggtgaggcaagataatg |
232 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41695199 |
gtttggcgagtctagataatgctcacaatttgtttgttcgtttatttgtttatttgatga----aagtactcacaatttgtttggtgaggcaagataatg |
41695104 |
T |
|
| Q |
233 |
cttaaaatttg-tttgtttgataagtcaaggtaattcctcacaatttgtttgtttgtttagttaagtgctcacattttgtttgtgaagcatcgtaatatt |
331 |
Q |
| |
|
|||| |||||| ||| |||| | ||||||||||||| ||||||||||||| | ||| || || |||||||| |||| | ||||||||| ||||||| |
|
|
| T |
41695103 |
cttagaatttgttttttttggtgagtcaaggtaatt-ctcacaatttgttgggttggtt--ccaaatgctcacaatttgaatatgaagcatcataatatt |
41695007 |
T |
|
| Q |
332 |
gtgattattttggata |
347 |
Q |
| |
|
||| || ||||||||| |
|
|
| T |
41695006 |
gtgtttgttttggata |
41694991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 19494414 - 19494356
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 22917563 - 22917621
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 1526175 - 1526115
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
1526175 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 14239081 - 14239025
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 27341592 - 27341536
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 43477162 - 43477218
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 16643659 - 16643718
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
16643659 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 16789369 - 16789314
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16789314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 16644045 - 16643987
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggt |
16643987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 29158351 - 29158409
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
29158351 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 35143847 - 35143789
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35143847 |
ataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 38930301 - 38930359
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggt |
38930359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 1525808 - 1525865
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctgg |
1525865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 4710222 - 4710165
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 11019859 - 11019802
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 28346760 - 28346703
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 32418317 - 32418370
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 32726273 - 32726216
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 33526414 - 33526357
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4017301 - 4017245
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 8094476 - 8094536
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
8094476 |
ataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggt |
8094536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 11976372 - 11976428
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 14238750 - 14238806
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14238806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 14495068 - 14495124
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 19494116 - 19494176
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
19494116 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
19494176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 24955012 - 24954956
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 28346393 - 28346449
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 29488111 - 29488055
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
29488055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 401
Target Start/End: Original strand, 33636319 - 33636375
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33636319 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 34963299 - 34963355
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 37536085 - 37536141
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 4375692 - 4375747
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
4375747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 7272751 - 7272696
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 7326421 - 7326366
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 401
Target Start/End: Complemental strand, 8094843 - 8094788
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 10776499 - 10776444
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 40066820 - 40066765
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 40844156 - 40844211
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 1685117 - 1685171
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
1685171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 6146948 - 6146894
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
6146894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 7326083 - 7326141
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7326083 |
ataggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 18549198 - 18549252
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
18549198 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 35097325 - 35097383
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35097325 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 35347001 - 35346943
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35347001 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 38930665 - 38930607
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 1162909 - 1162966
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
1162966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 3511904 - 3511961
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 3512268 - 3512211
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3512268 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 345 - 402
Target Start/End: Original strand, 5357420 - 5357477
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5357420 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 9175373 - 9175320
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 10337117 - 10337174
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 10337451 - 10337394
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 21126023 - 21125966
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
21126023 |
taggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 25702510 - 25702567
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35345619 - 35345562
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 40492958 - 40493015
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4474045 - 4473989
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 7272419 - 7272471
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 7420229 - 7420285
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 7420591 - 7420535
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 8298976 - 8298920
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 9496724 - 9496668
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 10540783 - 10540727
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 10872914 - 10872970
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 11019519 - 11019575
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 14488715 - 14488767
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 16789074 - 16789130
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 20277691 - 20277747
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 20984145 - 20984201
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21064318 - 21064374
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21125718 - 21125774
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 22650463 - 22650519
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 24187568 - 24187624
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg |
24187624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24187898 - 24187842
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25131110 - 25131166
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 32725906 - 32725962
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40066496 - 40066552
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 1408354 - 1408299
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 4621354 - 4621299
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 400
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 7186004 - 7185949
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 8298587 - 8298642
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 14489073 - 14489018
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 14496815 - 14496870
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 344 - 403
Target Start/End: Original strand, 17073803 - 17073862
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
17073803 |
gataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 344 - 403
Target Start/End: Complemental strand, 17574467 - 17574408
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
17574467 |
gataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 28323848 - 28323903
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 42133154 - 42133099
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 18549576 - 18549518
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
18549576 |
atagactaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 20278059 - 20278005
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 21064686 - 21064632
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 25600227 - 25600285
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
25600227 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 28399038 - 28398980
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
28399038 |
ataggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg |
28398980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 35115642 - 35115584
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
35115642 |
ataggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 4473702 - 4473759
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 6469278 - 6469335
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6469278 |
taggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 9496339 - 9496396
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 11976738 - 11976681
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 349 - 401
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 401
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2728231 - 2728287
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 10540447 - 10540503
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||| ||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
10540447 |
taggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 20984511 - 20984455
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 396
Target Start/End: Original strand, 10776141 - 10776196
Alignment:
| Q |
341 |
ttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
10776141 |
ttggattgtctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 27117977 - 27117922
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 13154883 - 13154941
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
13154883 |
ataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 19962992 - 19963050
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||| |||||||| ||||||||||||| |
|
|
| T |
19962992 |
ataggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 29992303 - 29992245
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29992303 |
ataggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 1163274 - 1163217
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||| |||||| ||||||||| ||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggt |
1163217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 4376012 - 4375960
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
4376012 |
taggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 13155253 - 13155196
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 27117751 - 27117808
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 28497254 - 28497307
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||| |||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 32040073 - 32040130
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
32040073 |
taggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 393
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtt |
393 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 3680802 - 3680746
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 9175011 - 9175067
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24815069 - 24815013
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 25600598 - 25600542
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 28324182 - 28324126
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 29158669 - 29158617
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 353 - 400
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 28258244 - 28258189
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||| ||||||||||||||||||| |
|
|
| T |
28258244 |
ataggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 394
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
394 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 351 - 398
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 348 - 397
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| |||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 3031602 - 3031545
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||| |||||| ||||||||| |
|
|
| T |
3031602 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctggt |
3031545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg |
13779204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||| ||||||| |||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 44997930 - 44997979
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 24954669 - 24954728
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
24954669 |
ataggctaaaatatgattt-agtttttgtaaatatgcctcgttttggttttagttcctggt |
24954728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 26530667 - 26530723
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||| |||| |||||||| |||| |
|
|
| T |
26530667 |
aggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 384
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctc |
384 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 42429757 - 42429812
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
7420346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
13232314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
20277808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
21064435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 24090118 - 24090173
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| || | |||| ||||| ||||||||| ||||||||||| |
|
|
| T |
24090118 |
aggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 400
Target Start/End: Original strand, 27341255 - 27341310
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |||||| ||||||||| |
|
|
| T |
27341255 |
ataggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtcc |
27341310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||| |||| || ||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctgg |
42430004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||| || ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| |||||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 346 - 376
Target Start/End: Complemental strand, 43477482 - 43477452
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43477482 |
taggctaaaatatggttttagtccctgtaaa |
43477452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 391
Target Start/End: Original strand, 2811437 - 2811478
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttgg |
391 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
2811437 |
ctaaaatatggttttggtctctgtaaatatgcttcgttttgg |
2811478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 6469669 - 6469612
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
6469669 |
taggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctg |
6469612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 383
Target Start/End: Complemental strand, 21509920 - 21509883
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcct |
383 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21509920 |
taggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Complemental strand, 32040341 - 32040312
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32040341 |
aggctaaaatatggttttagtccctgtaaa |
32040312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 13796593 - 13796541
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctg |
13796541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 384
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctc |
384 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 31445464 - 31445412
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 9e-25; HSPs: 224)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 26799887 - 26799945
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
26799945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 37506864 - 37506924
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37506864 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 3152113 - 3152054
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3152113 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
3152054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 16123139 - 16123194
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 20612899 - 20612841
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 28427609 - 28427551
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
28427551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 39437110 - 39437052
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39437052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 51834607 - 51834665
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 10976978 - 10977035
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
10977035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 3151748 - 3151804
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 4513262 - 4513318
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 4950036 - 4950092
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 12673643 - 12673699
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 22156292 - 22156236
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 37507223 - 37507167
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 48924241 - 48924185
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 25710870 - 25710815
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
25710815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 39288900 - 39288841
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39288900 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 51834944 - 51834885
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
51834885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 3830518 - 3830464
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3830518 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 13584368 - 13584310
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 28942906 - 28942848
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 39436717 - 39436775
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 3830132 - 3830189
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
3830189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 8510214 - 8510271
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggt |
8510271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 344 - 401
Target Start/End: Complemental strand, 9262159 - 9262102
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9262159 |
gataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 21159819 - 21159762
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 28552385 - 28552328
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 51550080 - 51550137
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 5345690 - 5345634
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
5345634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 22008525 - 22008581
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 22016043 - 22016099
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25615974 - 25616030
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 28427242 - 28427302
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
28427242 |
ataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 30268504 - 30268560
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 31480135 - 31480191
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 45320980 - 45320924
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
45320924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 54608517 - 54608573
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 9863404 - 9863349
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
9863349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 14633547 - 14633602
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggt |
14633602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 15016388 - 15016443
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 22155927 - 22155986
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
22155986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 29445954 - 29446009
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29446009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 34238596 - 34238655
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
34238655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 49323782 - 49323837
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 403
Target Start/End: Complemental strand, 49324150 - 49324091
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49324150 |
gataggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 275441 - 275499
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
275441 |
ataggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 10977342 - 10977284
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 20611019 - 20611077
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggt |
20611077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 30106223 - 30106165
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
30106223 |
ataggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 30130155 - 30130213
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
30130155 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 39288572 - 39288630
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt |
39288630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 45002018 - 45002076
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
45002018 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 47336584 - 47336526
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
47336584 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 50196660 - 50196602
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
50196660 |
ataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 51500395 - 51500449
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51500395 |
ataggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 54608866 - 54608808
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
54608866 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 345 - 402
Target Start/End: Original strand, 9603626 - 9603683
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9603626 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 12740905 - 12740962
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 28552019 - 28552076
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 28942522 - 28942575
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
28942522 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 29955300 - 29955353
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
29955353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 29955668 - 29955611
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 30004454 - 30004507
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30004507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 30004823 - 30004766
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 31869958 - 31869901
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
31869901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 40169654 - 40169597
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
40169597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 401
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 46751270 - 46751323
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 51550448 - 51550391
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 474043 - 474099
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 1721453 - 1721397
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 3361817 - 3361761
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
3361761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4513621 - 4513565
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctg |
4513565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 12741272 - 12741216
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 19844582 - 19844526
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 32119585 - 32119529
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 43441604 - 43441548
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 45002386 - 45002330
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 46186772 - 46186720
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 47336227 - 47336283
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 4034717 - 4034772
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 9261789 - 9261844
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 26090078 - 26090023
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 29446209 - 29446154
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
29446209 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 44802282 - 44802337
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 474411 - 474353
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
474411 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 14633890 - 14633832
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
14633832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 401
Target Start/End: Original strand, 14772210 - 14772264
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 34238916 - 34238858
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| |||||||||||||||||| |||| |
|
|
| T |
34238916 |
aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt |
34238858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 40169343 - 40169401
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 47005521 - 47005467
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 49670803 - 49670745
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccc-tgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 3387605 - 3387552
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 7518089 - 7518142
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 15979703 - 15979646
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 19656540 - 19656593
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 20757777 - 20757724
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
20757777 |
taggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc |
20757724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 21159452 - 21159505
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 25710508 - 25710565
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
25710508 |
taggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 28452378 - 28452321
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 29490745 - 29490692
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 29525104 - 29525157
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 40545562 - 40545619
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 52342584 - 52342531
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 9597096 - 9597040
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 9863045 - 9863100
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||| |||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 20644877 - 20644821
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
20644877 |
aggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21553888 - 21553944
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg |
21553944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 30552479 - 30552423
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35565507 - 35565563
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 40979711 - 40979655
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 47005153 - 47005209
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 51759818 - 51759874
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 349 - 397
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 4035053 - 4034998
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 4814899 - 4814845
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 7957226 - 7957171
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 354 - 405
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
354 |
aatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 9603922 - 9603871
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
9603922 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 400
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 39072213 - 39072158
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg |
39072158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 43440494 - 43440549
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 45313863 - 45313808
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 400
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 20907460 - 20907406
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
20907460 |
ataggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtc |
20907406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 27681685 - 27681627
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| | ||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
27681685 |
ataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 30034475 - 30034417
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
30034475 |
ataggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 351 - 401
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 52342193 - 52342243
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 7588316 - 7588369
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| ||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 30128282 - 30128339
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||| |||| |
|
|
| T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 30130505 - 30130452
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 401
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| | |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 32119218 - 32119275
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 403
Target Start/End: Original strand, 35498406 - 35498471
Alignment:
| Q |
338 |
attttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
35498406 |
atttttgataggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 46622131 - 46622074
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 46901101 - 46901154
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
46901101 |
ataggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 29678023 - 29678079
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40277821 - 40277877
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 45161116 - 45161164
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 19844265 - 19844320
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 25353198 - 25353241
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttg |
390 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25353198 |
aggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||| ||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 47902145 - 47902090
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg |
47902090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 13514579 - 13514525
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| |||| || |||| ||||||| ||||||||||||||||||| |
|
|
| T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 28452145 - 28452199
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| || |||||||||||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 35407793 - 35407735
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| || ||||| ||||||||||||| |
|
|
| T |
35407793 |
ataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 1721087 - 1721144
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||| |||| || ||||||| ||| |||||||||||||||||| |
|
|
| T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 351 - 400
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| |||| || |||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 338 - 403
Target Start/End: Original strand, 10778360 - 10778425
Alignment:
| Q |
338 |
attttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| | ||| ||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
10778360 |
attttgaaaaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| | || |||||| |||| |||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg |
14772470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 20405225 - 20405168
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| | | ||||| ||||||||||||| |
|
|
| T |
20405225 |
taggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 25609765 - 25609822
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
25609765 |
taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg |
25609822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 38232240 - 38232293
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 53632506 - 53632555
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
53632506 |
taaaatatggttttagtccctataaatatggttcgttttagttttagtcc |
53632555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 350 - 398
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| || ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 18175791 - 18175844
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctg |
18175844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 29686543 - 29686599
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| ||||||||||| |||| || ||||||| || ||||||||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 53113442 - 53113490
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||| |||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 54767524 - 54767472
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctg |
54767472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 374 - 405
Target Start/End: Complemental strand, 10778705 - 10778674
Alignment:
| Q |
374 |
aaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10778705 |
aaatatgcctcgttttggttttagtccctggt |
10778674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 351 - 398
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 19844339 - 19844382
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
19844339 |
ttttggtccctgtaaatatgcctcattttggttttggtccctgg |
19844382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 20644505 - 20644560
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 386
Target Start/End: Complemental strand, 26273825 - 26273786
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgt |
386 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
26273825 |
aggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 40370285 - 40370340
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||| |||||||| |||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 50009284 - 50009229
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| ||||||||| |||| || ||||||||||||||||| ||||| |||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg |
50009229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 50261936 - 50261885
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 53701361 - 53701416
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||| |||| ||||||||||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctg |
53701416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| ||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 369 - 403
Target Start/End: Original strand, 20907158 - 20907192
Alignment:
| Q |
369 |
cctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctg |
20907192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| | |||||| |||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 29678387 - 29678333
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 347 - 401
Target Start/End: Original strand, 35936779 - 35936833
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| | |||||||||||||| |||| |
|
|
| T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 36672960 - 36673014
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| |||||||||||||| ||| ||| ||||||| || ||||||||||||||| |
|
|
| T |
36672960 |
ataggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 49670477 - 49670531
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||| ||||||||| || ||||||| || |||||||||||| |||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggt |
49670531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 863279 - 863332
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||| |||| || ||||||| |||||||| ||||||||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc |
863332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||| |||||| | || ||||| ||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 358 - 403
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
358 |
tggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 380
Target Start/End: Complemental strand, 26800170 - 26800137
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
26800170 |
aggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 349 - 398
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 39132908 - 39132851
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| || | ||||||| |||||||| |
|
|
| T |
39132908 |
taggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctg |
39132851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 358 - 398
Target Start/End: Complemental strand, 16123491 - 16123452
Alignment:
| Q |
358 |
tggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
16123491 |
tggttttagtcc-tgcaaatatgcctcgttttggttttagt |
16123452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 398
Target Start/End: Original strand, 20404888 - 20404940
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||| | |||| |||||| ||||||| |||||||||| |
|
|
| T |
20404888 |
taggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 30552145 - 30552200
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||| |||||||||||||||| || || ||||||| || |||||||||||||||||| |
|
|
| T |
30552145 |
taggttaaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 34582523 - 34582579
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
34582523 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 39820666 - 39820606
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| | |||| |||||| ||||||||| |
|
|
| T |
39820666 |
ataggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
39820606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 44506581 - 44506629
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||||||||| |
|
|
| T |
44506581 |
aggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 398
Target Start/End: Original strand, 45313498 - 45313550
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| |||||||| ||||||| |
|
|
| T |
45313498 |
taggctaaaatatgattttggtccttgtaaatatgattcgttttgattttagt |
45313550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 51058593 - 51058645
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctg |
51058645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 9e-25; HSPs: 212)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 31258338 - 31258396
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
31258396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 3753573 - 3753517
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 18473269 - 18473329
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18473269 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18473329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 990381 - 990322
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
990381 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 13770486 - 13770544
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13770486 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13770544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 22919681 - 22919739
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22919681 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22919739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 26061955 - 26062013
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 32729050 - 32728992
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
32728992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 41358368 - 41358426
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 7001897 - 7001840
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7001840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 1810926 - 1810982
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 18302388 - 18302332
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 29072496 - 29072552
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29072552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 45368489 - 45368545
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 18473596 - 18473541
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 33379887 - 33379942
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 35308111 - 35308056
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35308056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 45290822 - 45290763
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 990087 - 990145
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggt |
990145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 3753214 - 3753268
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3753268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 19623018 - 19622960
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 35005746 - 35005692
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 45290456 - 45290514
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
45290514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 47819229 - 47819287
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47819229 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 11822003 - 11822056
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 13260323 - 13260266
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 21391094 - 21391151
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 32454296 - 32454239
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
32454296 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctg |
32454239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 349 - 402
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 50429211 - 50429154
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
50429154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 50799128 - 50799185
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 3679625 - 3679681
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
3679681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 6567497 - 6567441
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 12361010 - 12361066
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctg |
12361066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 14007488 - 14007544
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14007544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 19622653 - 19622709
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24507844 - 24507788
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 26442900 - 26442844
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
26442844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 33045691 - 33045635
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35005443 - 35005499
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35307714 - 35307770
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 38164296 - 38164240
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 41358666 - 41358606
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
41358666 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
41358606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 47819597 - 47819541
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 29072862 - 29072807
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 29688429 - 29688374
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 38151212 - 38151157
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 44641432 - 44641377
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
44641377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 48956066 - 48956011
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
48956011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 52254479 - 52254424
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 16026941 - 16026883
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16026941 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 26324582 - 26324640
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26324582 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 35056897 - 35056839
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35056897 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 39747838 - 39747780
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
39747838 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 41881092 - 41881150
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggt |
41881150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 3247564 - 3247507
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 8140432 - 8140489
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 11822367 - 11822310
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 13259986 - 13260043
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg |
13260043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 15516580 - 15516637
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 24649662 - 24649605
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
24649662 |
taggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 30323295 - 30323238
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 45380270 - 45380327
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 48609596 - 48609543
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 52254182 - 52254235
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 3247197 - 3247253
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 8140800 - 8140744
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 10631529 - 10631473
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 10887600 - 10887544
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 12360969 - 12360913
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 15211510 - 15211562
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 15526363 - 15526307
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 17984332 - 17984384
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 18900130 - 18900078
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
18900078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 19720711 - 19720767
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 21391371 - 21391323
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtc |
21391323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 26191359 - 26191411
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 30322928 - 30322984
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 32626528 - 32626584
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 33000670 - 33000614
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 33234545 - 33234601
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 34002941 - 34002885
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 46868577 - 46868521
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 48609235 - 48609291
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 3679986 - 3679931
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 10631164 - 10631219
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 16060885 - 16060830
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 44158043 - 44157988
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 21383101 - 21383159
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
21383101 |
ataggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
21383159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 22919979 - 22919925
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
22919979 |
taggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 26324950 - 26324896
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
26324950 |
ataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 34808194 - 34808252
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34808194 |
ataggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || |||| |||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 349 - 398
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 7819105 - 7819052
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 7867127 - 7867184
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| |||||||| ||||||||||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 10887231 - 10887288
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 397
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 33045353 - 33045410
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 37624745 - 37624798
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 45368847 - 45368794
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctg |
45368794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24654168 - 24654112
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 12322970 - 12322915
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 400
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 390
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttg |
390 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 33234912 - 33234857
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 41738796 - 41738851
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 41739122 - 41739068
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 350 - 401
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 12360600 - 12360658
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| |||| ||||||| ||||| |
|
|
| T |
12360600 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 15334915 - 15334965
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
15334915 |
taggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 33067346 - 33067400
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| |||||||||||||| |||| |
|
|
| T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 37625026 - 37624976
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 42482976 - 42483030
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
42482976 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45638896 - 45638846
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 357 - 402
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
357 |
atggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4360627 - 4360571
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| |||||||| ||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg |
4360571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 7867358 - 7867302
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 14007876 - 14007824
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
14007876 |
aggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtc |
14007824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 16060595 - 16060646
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccctc-aaatatgcctcgttttggttttagtc |
16060646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 18079397 - 18079453
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||||| |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 31061152 - 31061096
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| |||||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 50428872 - 50428928
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||||||| ||||| |||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 15211858 - 15211803
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||||||||||||| | |||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 16026572 - 16026627
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 20948755 - 20948810
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 25658014 - 25658069
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||| ||||||||||||||| |||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 34383244 - 34383189
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctg |
34383189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| | |||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 49073690 - 49073745
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||||||||||||| ||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 4565339 - 4565281
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| | ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
4565339 |
ataggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 22674200 - 22674254
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| |||||||||||||||||| |
|
|
| T |
22674200 |
ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 28507461 - 28507403
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||| ||| |||| ||||||||||||| |
|
|
| T |
28507461 |
ataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc |
34382997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 351 - 400
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| ||| ||| |||||| |||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 8364918 - 8364861
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||| ||||| | ||||||| |||||||||||||| ||||||| |
|
|
| T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 20756022 - 20756071
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||| ||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtcc |
20756071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 21383430 - 21383373
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||| ||| || ||||||||||| ||||| |||||||||||| |
|
|
| T |
21383430 |
taggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg |
21383373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 26142418 - 26142471
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| |||||| || | | |||||||||||||||||||||||||| |
|
|
| T |
26142418 |
taggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtc |
26142471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 33380257 - 33380204
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccc-tgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 345 - 390
Target Start/End: Original strand, 36912850 - 36912895
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttg |
390 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
36912850 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 49074055 - 49074006
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||| |||| |
|
|
| T |
49074055 |
taggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 49923820 - 49923763
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||| ||| |||||||| |||||||| |||||||||||| |
|
|
| T |
49923820 |
taggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 172
Target Start/End: Complemental strand, 19825222 - 19825182
Alignment:
| Q |
132 |
ttgtttggtgaatctagataatgctcacaatttgtttgttt |
172 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
19825222 |
ttgtttggtgagtcaagataatgctcacaatttgtttgttt |
19825182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24978123 - 24978067
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||| |||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
24978123 |
aggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 39747473 - 39747528
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 42483272 - 42483224
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| | ||||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 46184051 - 46183999
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctg |
46183999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 46868225 - 46868277
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
46868225 |
aggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtc |
46868277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 1159839 - 1159784
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||| | || |||| ||||| ||||||||||||||||||| |
|
|
| T |
1159839 |
ggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg |
1159784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 398
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 18079472 - 18079515
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18079472 |
ttttggtccctgtaaatatgcctcgttttggttttggtctctgg |
18079515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 376
Target Start/End: Complemental strand, 37545921 - 37545890
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37545921 |
ataggctaaaatatggttttagtccctgtaaa |
37545890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 4617085 - 4617139
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
4617085 |
ataggttaaaatatggttttggtccctgaaaatatgtttcgttttagttttagtc |
4617139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 365 - 403
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
| Q |
365 |
agtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctg |
18302108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 30962413 - 30962471
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
30962413 |
ataggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 47038865 - 47038923
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| || |||| |||||| ||||||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggt |
47038923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Complemental strand, 10552285 - 10552256
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10552285 |
aggctaaaatatggttttagtccctgtaaa |
10552256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 19825222 - 19825181
Alignment:
| Q |
210 |
ttgtttggtgaggcaagataatgcttaaaatttgtttgtttg |
251 |
Q |
| |
|
|||||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
19825222 |
ttgtttggtgagtcaagataatgctcacaatttgtttgtttg |
19825181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 25658299 - 25658246
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 349 - 390
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttg |
390 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 26699608 - 26699556
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||| ||||||| ||||||||| |
|
|
| T |
26699608 |
taggctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagtc |
26699556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||| |||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg |
29579375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 31404724 - 31404667
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||| |||||| | ||||||||||||| |
|
|
| T |
31404724 |
taggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 12322604 - 12322656
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||| ||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 349 - 401
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||| ||| |||| ||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 32035791 - 32035747
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgtttt |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| || ||||| |
|
|
| T |
32035791 |
ataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||| |||| |||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 211)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 35415296 - 35415356
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35415296 |
ataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
35415356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 35763645 - 35763704
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35763645 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 41345852 - 41345910
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 41620257 - 41620199
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
41620199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 35415633 - 35415576
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 123531 - 123591
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
123531 |
ataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 9289263 - 9289323
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
9289263 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 13064466 - 13064410
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 16712692 - 16712636
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16712636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 52017504 - 52017560
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 52017871 - 52017815
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 18205155 - 18205210
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 32208541 - 32208596
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 41619897 - 41619956
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 53717174 - 53717119
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 6827875 - 6827817
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 46088062 - 46088004
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 51545972 - 51545914
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51545972 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51545914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 13064157 - 13064214
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
13064214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 13479613 - 13479556
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 32365092 - 32365149
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 50714240 - 50714297
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 50714565 - 50714508
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
50714508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 2034856 - 2034800
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2180219 - 2180275
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 13530714 - 13530658
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 24774044 - 24774100
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 29463914 - 29463858
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctg |
29463858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 29499181 - 29499237
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 30046793 - 30046737
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 30061134 - 30061078
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 32365484 - 32365428
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 35763958 - 35763898
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
35763958 |
ataggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggt |
35763898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 38054549 - 38054601
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38054601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 43231390 - 43231334
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 45505599 - 45505655
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 45505895 - 45505839
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 55072388 - 55072444
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 9289641 - 9289582
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 24474964 - 24474909
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 27008084 - 27008139
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 28809181 - 28809126
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 46115414 - 46115469
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 46128548 - 46128603
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 51708691 - 51708750
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggt |
51708750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 4211559 - 4211617
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 6827545 - 6827603
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggt |
6827603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 18831181 - 18831123
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18831181 |
atagactaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 34355286 - 34355228
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34355286 |
ataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 51709028 - 51708970
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggt |
51708970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 52441760 - 52441818
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
52441760 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
52441818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 53915680 - 53915738
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
53915680 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 55072715 - 55072657
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
55072715 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 5052585 - 5052532
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 5882550 - 5882606
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
5882550 |
taggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 12791976 - 12791919
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 13631226 - 13631283
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 14487800 - 14487857
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 19321568 - 19321625
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 29380911 - 29380858
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 34361802 - 34361855
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 35464016 - 35464073
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 52430102 - 52430045
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 5827974 - 5827918
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 8760782 - 8760726
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 13631600 - 13631544
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 14791807 - 14791751
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 22099913 - 22099861
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25423923 - 25423979
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 25424313 - 25424257
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 29420539 - 29420483
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 36701999 - 36702055
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 43231087 - 43231143
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 46115780 - 46115724
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 46128914 - 46128858
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 46292652 - 46292600
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 51545628 - 51545680
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 52442093 - 52442037
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 54903476 - 54903420
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 8191391 - 8191336
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 9446323 - 9446268
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctg |
9446268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 13073759 - 13073814
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 32208902 - 32208847
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 41346220 - 41346161
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| |||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggt |
41346161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 400
Target Start/End: Original strand, 53716918 - 53716973
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
53716918 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 55482468 - 55482413
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg |
55482413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 11693124 - 11693066
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
11693124 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 13074127 - 13074073
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 20291983 - 20292037
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
20291983 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 22584284 - 22584338
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
22584284 |
ataggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 26412187 - 26412245
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26412187 |
ataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 353 - 403
Target Start/End: Complemental strand, 27008401 - 27008351
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
27008351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 30060766 - 30060824
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
30060766 |
ataggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 53916050 - 53915992
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
53916050 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 4279020 - 4279077
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 12152495 - 12152438
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 349 - 402
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 13764808 - 13764755
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 14488189 - 14488132
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 22584609 - 22584552
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
22584609 |
taggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg |
22584552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 23245597 - 23245540
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 29380667 - 29380724
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 43368467 - 43368520
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
43368520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 45593226 - 45593283
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
45593226 |
taggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg |
45593283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 45593588 - 45593531
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 353 - 401
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 8760603 - 8760659
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 23779226 - 23779170
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 26314333 - 26314277
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 27427871 - 27427926
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 31560330 - 31560386
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 31812214 - 31812158
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35119291 - 35119347
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 36054151 - 36054095
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 42848026 - 42848082
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 335 - 403
Target Start/End: Complemental strand, 44925858 - 44925790
Alignment:
| Q |
335 |
attattttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| | | |||||||||||||||| ||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
44925858 |
attattttgcaaatgctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 45474597 - 45474545
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 5827655 - 5827710
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 19321859 - 19321804
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 28809011 - 28809066
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 31560695 - 31560640
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 41324890 - 41324835
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 53308068 - 53308013
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 2034544 - 2034594
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 8905234 - 8905180
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 12152151 - 12152209
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
12152151 |
ataggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 13530376 - 13530434
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
13530376 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 51738134 - 51738192
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
51738134 |
ataggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg |
51738192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 24474599 - 24474651
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 31370801 - 31370854
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31370801 |
ataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 37556839 - 37556896
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| || || |||||| ||||| ||||||||||||||||| |
|
|
| T |
37556839 |
taggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 41921085 - 41921032
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 42823774 - 42823831
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 47023107 - 47023050
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 51738413 - 51738356
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||||| |||| ||||||| |
|
|
| T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 2180572 - 2180520
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 2322433 - 2322377
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcg-ttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 11692760 - 11692816
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
11692760 |
taggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 18136114 - 18136058
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18136114 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 31182505 - 31182449
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 31811924 - 31811980
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 49123322 - 49123266
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49123322 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 344 - 403
Target Start/End: Complemental strand, 5797824 - 5797765
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||| |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
5797824 |
gataggttaaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 35119614 - 35119559
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||| ||||||||||||| ||||| |
|
|
| T |
35119614 |
ataggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 400
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 14594204 - 14594258
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
14594204 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 35420388 - 35420446
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||||||||||| ||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
35420388 |
atagtctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 41439784 - 41439838
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
41439784 |
ataggttaaaatatggttttagcctctgtaaatatttctcgttttggttttagtc |
41439838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 3653742 - 3653689
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3653742 |
tagggtaacatatgattttagtccctgtaaatataccttgttttggttttagtc |
3653689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 20144732 - 20144683
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| || | || ||||||||||||||||||||||| |
|
|
| T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||| |||| ||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| ||||||||||||| | ||||| || ||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg |
51830944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| ||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 42824091 - 42824039
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || |||||| ||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 51762869 - 51762925
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| || ||| ||| |||||||| || |||||||||||||||||| |
|
|
| T |
51762869 |
aggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg |
51762925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 376
Target Start/End: Original strand, 18830874 - 18830905
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18830874 |
ataggctaaaatatggttttagtccctgtaaa |
18830905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 26313988 - 26314043
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 404
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
36050402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 351 - 398
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 364 - 403
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
| Q |
364 |
tagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctg |
54208516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 19903258 - 19903316
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
19903258 |
ataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctg |
19903316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 353 - 403
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 375
Target Start/End: Complemental strand, 4211820 - 4211791
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4211820 |
taggctaaaatatggttttagtccctgtaa |
4211791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 358 - 403
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
358 |
tggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Complemental strand, 31371001 - 31370972
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31371001 |
aggctaaaatatggttttagtccctgtaaa |
31370972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 5063013 - 5063064
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||| |||||||||| |||||||| |
|
|
| T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccctg |
5063064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 376
Target Start/End: Complemental strand, 5063333 - 5063305
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5063333 |
ggctaaaatatggttttagtccctgtaaa |
5063305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 336 - 376
Target Start/End: Complemental strand, 11285847 - 11285807
Alignment:
| Q |
336 |
ttattttggataggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
11285847 |
ttattttttataggttaaaatatggttttagtccctgtaaa |
11285807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||| || |||||||||||||| |||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 50822295 - 50822239
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| ||| | ||| |||||||||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctg |
50822239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| ||||| || | || |||||||||| |||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 6e-23; HSPs: 148)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 7156162 - 7156103
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 15076205 - 15076147
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15076147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 24274132 - 24274074
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 33801744 - 33801686
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
33801686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 33808619 - 33808677
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 8680772 - 8680832
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8680772 |
ataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8680832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 12419941 - 12419881
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12419941 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 31166871 - 31166927
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
31166927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 32885670 - 32885730
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32885670 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
32885730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 1890454 - 1890395
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 14655377 - 14655436
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 15962389 - 15962334
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 34582529 - 34582584
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
34582584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 1007512 - 1007454
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1007512 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 1890062 - 1890116
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
1890116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 3969012 - 3968954
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3969012 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 7155796 - 7155854
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7155854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 8681117 - 8681059
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 22543351 - 22543409
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22543351 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 22822652 - 22822594
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 25137360 - 25137302
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25137360 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 3414385 - 3414442
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 15962025 - 15962082
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 21994405 - 21994348
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 25431856 - 25431799
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 34582894 - 34582837
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 494405 - 494457
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 346 - 402
Target Start/End: Original strand, 2615870 - 2615926
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 3414753 - 3414697
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21995063 - 21995119
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 30928680 - 30928736
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 351 - 402
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 400
Target Start/End: Original strand, 12419705 - 12419760
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
12419705 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 19267565 - 19267620
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 19296407 - 19296352
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 30929044 - 30928989
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30928989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 7324195 - 7324137
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7324195 |
ataggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 10910967 - 10910909
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10910967 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 14428651 - 14428705
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
14428705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 20467721 - 20467663
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
20467721 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 21147401 - 21147459
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21147401 |
ataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 401
Target Start/End: Complemental strand, 22792900 - 22792846
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 1007122 - 1007179
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 3356141 - 3356194
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 6412216 - 6412273
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 12176645 - 12176588
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 12612361 - 12612304
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12612361 |
taggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg |
12612304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 22543720 - 22543663
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 24692981 - 24692924
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 31167200 - 31167143
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2373178 - 2373234
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 3968644 - 3968700
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 6412580 - 6412524
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 6468309 - 6468365
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 11449170 - 11449114
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 12299141 - 12299085
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 346 - 398
Target Start/End: Complemental strand, 19321133 - 19321081
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 19690392 - 19690448
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21385250 - 21385306
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 21385585 - 21385529
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 23502541 - 23502485
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 24273827 - 24273883
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25136993 - 25137049
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 33131851 - 33131795
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 13268108 - 13268163
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 404
Target Start/End: Original strand, 19129333 - 19129392
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
|||||||| ||||||| ||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19129333 |
ataggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg |
19129392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 21995425 - 21995370
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 318100 - 318042
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
318100 |
ataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 777676 - 777734
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt |
777734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 401
Target Start/End: Original strand, 11448536 - 11448590
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 21993784 - 21993842
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21993784 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 317810 - 317867
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg |
317867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 3276355 - 3276302
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 8170153 - 8170100
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 9896638 - 9896585
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 18024377 - 18024320
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 346 - 398
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 10091039 - 10091091
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
10091091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 12757609 - 12757661
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 14656261 - 14656205
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 19296107 - 19296163
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 26375692 - 26375748
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctg |
26375748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 543726 - 543667
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| | |||||||||||| |||||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggt |
543667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 346 - 389
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgtttt |
389 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 31186591 - 31186536
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| || |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 400
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 348 - 402
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 19129522 - 19129465
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 25121498 - 25121441
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 31398542 - 31398489
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 1214998 - 1214942
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
1214998 |
taggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 12176385 - 12176437
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||| |||||||||| |
|
|
| T |
12176385 |
ggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtcc |
12176437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 13150751 - 13150695
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 19267913 - 19267857
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| | | |||||||||||||||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctg |
19267857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 393
Target Start/End: Original strand, 30479060 - 30479108
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
30479060 |
ataggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 10910629 - 10910684
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 395
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 360 - 403
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
| Q |
360 |
gttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 402
Target Start/End: Original strand, 6564578 - 6564636
Alignment:
| Q |
345 |
ataggctaaaatatggttttag-tccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||| ||||||||| | |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
6564578 |
ataggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| |||||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 1875500 - 1875557
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| | |||| |||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
1875500 |
taggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg |
1875557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 6564945 - 6564893
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
6564945 |
taggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||| |||| ||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg |
9896333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 345 - 398
Target Start/End: Complemental strand, 11926036 - 11925983
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||| | ||||||||||||||| |
|
|
| T |
11926036 |
ataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 398
Target Start/End: Original strand, 15116671 - 15116721
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
15116671 |
taggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt |
15116721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 384
Target Start/End: Complemental strand, 15117041 - 15117004
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15117041 |
aggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 15722608 - 15722665
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 19276041 - 19275984
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
19276041 |
taggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctg |
19275984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||| ||||||||||| |||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 17765376 - 17765320
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25431575 - 25431631
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
25431575 |
aggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctg |
25431631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 1214695 - 1214750
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| | | ||||||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 376
Target Start/End: Complemental strand, 2373467 - 2373436
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2373467 |
ataggctaaaatatggttttagtccctgtaaa |
2373436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 14655903 - 14655958
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg |
14655958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 376
Target Start/End: Original strand, 19275711 - 19275742
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19275711 |
ataggctaaaatatggttttagtccctgtaaa |
19275742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 25121180 - 25121234
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||| |||||||||||||||||| |
|
|
| T |
25121180 |
gataggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 346 - 376
Target Start/End: Complemental strand, 6468645 - 6468615
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6468645 |
taggctaaaatatggttttagtccctgtaaa |
6468615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 12611995 - 12612045
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt |
12612045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 31276339 - 31276285
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 17321228 - 17321257
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17321228 |
aggctaaaatatggttttagtccctgtaaa |
17321257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 24901556 - 24901499
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||| || |||||||||||||||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctg |
24901499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 361 - 405
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctggt |
19275179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 19690755 - 19690708
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 349 - 393
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtt |
393 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 375
Target Start/End: Original strand, 33131554 - 33131582
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaa |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33131554 |
aggctaaaatatggttttagtccctgtaa |
33131582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 6e-23; HSPs: 171)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 29875727 - 29875668
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 18633598 - 18633656
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 29172887 - 29172829
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 30800491 - 30800549
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30800491 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 5950174 - 5950231
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
5950231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 29692742 - 29692799
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 30800852 - 30800795
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2217493 - 2217549
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 7075571 - 7075627
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 28863509 - 28863565
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 29172524 - 29172580
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 34125633 - 34125577
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 35167166 - 35167110
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 36578084 - 36578028
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 28550827 - 28550882
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28550882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 28863838 - 28863783
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 40029497 - 40029442
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 10408927 - 10408985
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
10408985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 12144904 - 12144962
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12144904 |
ataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 15635708 - 15635650
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 18046350 - 18046296
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 24443747 - 24443689
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24443747 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 36577719 - 36577777
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36577719 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36577777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 1105150 - 1105093
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 5614532 - 5614475
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 6118499 - 6118442
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggt |
6118442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 10743723 - 10743776
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 16038376 - 16038429
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 18633961 - 18633904
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggt |
18633904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 19565833 - 19565776
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 25561705 - 25561762
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggt |
25561762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 42207240 - 42207297
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctg |
42207297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 1381612 - 1381556
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 5917461 - 5917405
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 11799459 - 11799403
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 19685381 - 19685325
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 26133414 - 26133358
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35928063 - 35928119
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 38170513 - 38170569
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 38786158 - 38786214
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
38786214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 39379236 - 39379296
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39379236 |
ataggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40029140 - 40029196
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg |
40029196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40167785 - 40167841
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40764414 - 40764470
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 10409328 - 10409269
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggt |
10409269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 403
Target Start/End: Original strand, 19685013 - 19685072
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19685013 |
gataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 25562001 - 25561942
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggt |
25561942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 26133183 - 26133238
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 33336026 - 33335971
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
33335971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 39379612 - 39379553
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt |
39379553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 5917123 - 5917181
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5917123 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 24781986 - 24782044
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24781986 |
ataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 29151852 - 29151794
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 29875399 - 29875457
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggt |
29875457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 34125305 - 34125359
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 38496783 - 38496725
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 293827 - 293880
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 1104856 - 1104913
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 3850601 - 3850544
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 4203772 - 4203715
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 10744056 - 10743999
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
10743999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 13990896 - 13990843
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 20660947 - 20661000
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 29151516 - 29151573
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggt |
29151573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 37271357 - 37271414
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 1381246 - 1381302
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 9179921 - 9179865
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctg |
9179865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 11799128 - 11799184
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 18046037 - 18046093
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 19565466 - 19565522
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 20986090 - 20986034
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 21124912 - 21124968
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 24443379 - 24443435
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35876687 - 35876743
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 40764781 - 40764725
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 45138 - 45193
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 400
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 21050913 - 21050858
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 29366949 - 29366894
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 30888160 - 30888215
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 35166160 - 35166101
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggt |
35166101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 35928458 - 35928403
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 14318043 - 14318097
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 20690730 - 20690784
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20690730 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 23381947 - 23382005
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||| |||| |
|
|
| T |
23381947 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 31037743 - 31037693
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31037743 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 397
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 40168011 - 40167953
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
40168011 |
ataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 3851331 - 3851274
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 5614165 - 5614218
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 400
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 399
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 18258528 - 18258475
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 25779164 - 25779107
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || ||||||||||||| |||| |
|
|
| T |
25779164 |
taggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 28213372 - 28213425
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 29693091 - 29693038
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35877054 - 35876997
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
35876997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 3850299 - 3850355
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgg-ttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg |
3850355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4736543 - 4736487
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 9179592 - 9179648
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 18258161 - 18258217
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 20683746 - 20683802
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| |||||||| |||||||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 28871995 - 28871939
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 37271707 - 37271651
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| || |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 20661311 - 20661256
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 35609303 - 35609358
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 15635379 - 15635433
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| || ||||||| || ||||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggt |
15635433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 17070866 - 17070808
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| ||||||| ||||| |
|
|
| T |
17070866 |
ataggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg |
17070808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 5904006 - 5904063
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 350 - 402
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 38555085 - 38555030
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
38555085 |
taggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| | |||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 355 - 405
Target Start/End: Original strand, 6118139 - 6118190
Alignment:
| Q |
355 |
atatggttttagtccctgtaaatatgcctcgtttt-ggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt |
6118190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 21050575 - 21050630
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctg |
21050630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 40038491 - 40038542
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
40038491 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 40038858 - 40038803
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 402
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 347 - 401
Target Start/End: Original strand, 20416359 - 20416413
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||| |||||||| |||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 22551318 - 22551268
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtc |
22551268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 29855614 - 29855668
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 391
Target Start/End: Original strand, 7085476 - 7085520
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttgg |
391 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
7085476 |
taggctaaaatatggtttt-gtccctgtaaatatgccttgttttgg |
7085520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 10830527 - 10830584
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||| |||||||||||||| |||| |
|
|
| T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 28871635 - 28871692
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||||| |||| ||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
28871635 |
taggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| |||||| |||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc |
31037446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 32108806 - 32108863
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||| |||||| |||||| |
|
|
| T |
32108806 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 17070534 - 17070589
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||| |||| |||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 26071290 - 26071346
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 26071613 - 26071561
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| |||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 38496418 - 38496476
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| || ||||||||||||||| |||| |
|
|
| T |
38496418 |
taggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtccttggt |
38496476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 350 - 404
Target Start/End: Complemental strand, 12145181 - 12145127
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||| |||| ||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg |
12145127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||| || |||||||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 351 - 401
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
401 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 350 - 400
Target Start/End: Original strand, 22550960 - 22551010
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| ||||| |||| |
|
|
| T |
22550960 |
ctaaaatatggttttagtacatgtaaatatgtctcgttttagtttttgtcc |
22551010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| | ||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 38554749 - 38554800
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
38554749 |
taggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtc |
38554800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 9532221 - 9532250
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9532221 |
aggctaaaatatggttttagtccctgtaaa |
9532250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 13990634 - 13990663
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13990634 |
aggctaaaatatggttttagtccctgtaaa |
13990663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 399
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||| |||| || |||| ||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 27850048 - 27850077
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27850048 |
aggctaaaatatggttttagtccctgtaaa |
27850077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 37090417 - 37090446
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37090417 |
aggctaaaatatggttttagtccctgtaaa |
37090446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 3938122 - 3938062
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| | |||| |||||| ||||||||| |
|
|
| T |
3938122 |
ataggctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctggt |
3938062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 5103648 - 5103696
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| || | |||||||||| ||||||||||||||| |
|
|
| T |
5103648 |
ggctaaaatatgattttggttcatgtaaatatgactcgttttggtttta |
5103696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 349 - 400
Target Start/End: Complemental strand, 9588611 - 9588559
Alignment:
| Q |
349 |
gctaaaatatggttttag-tccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||| |||| | |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 30888432 - 30888380
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
30888432 |
aggctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtc |
30888380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 393
Target Start/End: Original strand, 31602140 - 31602188
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtt |
393 |
Q |
| |
|
|||||||||||||| ||||| |||||| |||||||| ||||||||||| |
|
|
| T |
31602140 |
ataggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 376
Target Start/End: Complemental strand, 37090716 - 37090688
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37090716 |
ggctaaaatatggttttagtccctgtaaa |
37090688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 189)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 6108333 - 6108391
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 17999724 - 17999666
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17999724 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
17999666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 44509055 - 44508997
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 1006835 - 1006892
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 5354766 - 5354823
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 44508720 - 44508777
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 12894403 - 12894347
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 19757747 - 19757803
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 28911907 - 28911851
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 35015223 - 35015163
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
35015223 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
35015163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 23676455 - 23676397
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23676455 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 26878074 - 26878016
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26878074 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 28911574 - 28911632
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
28911574 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
28911632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 48192491 - 48192433
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48192491 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 8144660 - 8144603
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 20388272 - 20388329
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20388272 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20388329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 23399610 - 23399667
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 29198664 - 29198607
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 39438739 - 39438792
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 39832904 - 39832961
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39832961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 1614905 - 1614849
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 3975548 - 3975604
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 6509207 - 6509263
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 6509471 - 6509415
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 8555800 - 8555744
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 9659690 - 9659634
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 25988750 - 25988694
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 37372905 - 37372849
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctg |
37372849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 44344790 - 44344734
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
44344734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 45073642 - 45073586
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45073586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 45228919 - 45228863
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 10358368 - 10358313
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 16853589 - 16853534
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 18022707 - 18022652
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18022707 |
ataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 21223749 - 21223694
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 35210515 - 35210460
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 39833236 - 39833181
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 1614556 - 1614614
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1614556 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 3975840 - 3975786
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 10357998 - 10358056
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10357998 |
ataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg |
10358056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 14739005 - 14738947
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 21554756 - 21554698
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
21554756 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctg |
21554698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 30352563 - 30352617
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggt |
30352617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 23816668 - 23816721
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
23816668 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 25988383 - 25988440
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 30352904 - 30352847
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
30352847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35104297 - 35104240
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 35665875 - 35665932
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35665875 |
taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35838339 - 35838282
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 39719644 - 39719587
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
39719644 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 41054238 - 41054181
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41054238 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 345 - 398
Target Start/End: Complemental strand, 45021859 - 45021806
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
45021859 |
ataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 45073312 - 45073369
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 1559706 - 1559650
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctg |
1559650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 5233807 - 5233863
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 8144294 - 8144350
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 13769774 - 13769826
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 13770082 - 13770026
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 23399977 - 23399921
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25092159 - 25092215
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 25092549 - 25092493
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 27458398 - 27458454
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 403
Target Start/End: Original strand, 28262704 - 28262768
Alignment:
| Q |
339 |
ttttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
28262704 |
ttttgaataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 44402959 - 44403015
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgtttt-ggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 1974009 - 1974064
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 400
Target Start/End: Original strand, 19783812 - 19783867
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
19783812 |
ataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 25547490 - 25547435
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25547435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 31732101 - 31732156
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 12932786 - 12932728
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
12932786 |
ataggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 29198300 - 29198358
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
29198300 |
ataggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 400
Target Start/End: Original strand, 46759656 - 46759710
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 400
Target Start/End: Original strand, 48852434 - 48852496
Alignment:
| Q |
338 |
attttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||| |||||||||||||||| |||||||||| |
|
|
| T |
48852434 |
atttttgaaaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 1007229 - 1007172
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggt |
1007172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 11767277 - 11767220
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 23676130 - 23676187
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 25547250 - 25547303
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
25547250 |
ataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 30223796 - 30223743
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 30709646 - 30709593
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 35837923 - 35837976
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 38486792 - 38486739
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
38486792 |
taggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 46304085 - 46304138
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 1559342 - 1559398
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 2945846 - 2945790
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 5234205 - 5234149
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 5308687 - 5308632
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctg |
5308632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 16940761 - 16940817
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 23817035 - 23816979
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 30223460 - 30223516
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 39439030 - 39438974
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 41053841 - 41053897
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 336 - 400
Target Start/End: Original strand, 43300600 - 43300664
Alignment:
| Q |
336 |
ttattttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
43300600 |
ttatttttaatatgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 44568325 - 44568381
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 44568691 - 44568635
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 46828943 - 46828999
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 5308323 - 5308378
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| |||||||| ||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 20388675 - 20388620
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 394
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 46304384 - 46304329
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 357 - 403
Target Start/End: Complemental strand, 1271590 - 1271544
Alignment:
| Q |
357 |
atggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 5355120 - 5355066
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| |||| ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
5355120 |
ataggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 6847122 - 6847068
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
6847122 |
atagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 9659352 - 9659410
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
9659352 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 19465983 - 19465926
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
19465983 |
ataggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg |
19465926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 347 - 397
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 45228612 - 45228670
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| | ||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
45228612 |
ataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 400
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 14543709 - 14543762
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 349 - 398
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 31310363 - 31310416
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35470282 - 35470225
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35470282 |
taggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 349 - 398
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 489073 - 489017
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 26877677 - 26877733
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 35104077 - 35104133
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 398
Target Start/End: Original strand, 38486476 - 38486528
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 39520397 - 39520453
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 44958507 - 44958451
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 41364884 - 41364939
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg |
41364939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 46829312 - 46829257
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 7432249 - 7432195
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggt |
7432195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 400
Target Start/End: Complemental strand, 18311938 - 18311888
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagtcc |
18311888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| |||||| |||||| ||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 45671211 - 45671269
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||| ||||||||||||||||||| || ||||||| |||||||| |||||||| |||| |
|
|
| T |
45671211 |
ataggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 3807862 - 3807919
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||| || |||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 6892262 - 6892205
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||| || ||||||| ||||||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 351 - 400
Target Start/End: Original strand, 14738603 - 14738652
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 22539928 - 22539985
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 35210180 - 35210237
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| |||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
35210180 |
taggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg |
43058805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 345 - 402
Target Start/End: Complemental strand, 45671551 - 45671494
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
45671551 |
ataggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || |||| |||||| |||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 403
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
| Q |
363 |
ttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctg |
12894096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 403
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
| Q |
363 |
ttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctg |
19758004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 356 - 400
Target Start/End: Original strand, 24953828 - 24953872
Alignment:
| Q |
356 |
tatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 48854071 - 48854015
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||| |||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 350 - 397
Target Start/End: Complemental strand, 20355768 - 20355721
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttag |
397 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagttttag |
20355721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 18926884 - 18926942
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||||||| | | ||||||| ||||||||||||| |||||||| |
|
|
| T |
18926884 |
atagactaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg |
18926942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 361 - 403
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 338 - 396
Target Start/End: Original strand, 44344447 - 44344505
Alignment:
| Q |
338 |
attttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||| | ||||||||||||||||||||| || | ||||||| ||||||| ||||||| |
|
|
| T |
44344447 |
attttgtaaaggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 6911081 - 6911134
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||| ||||||||| ||||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 19465650 - 19465679
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19465650 |
aggctaaaatatggttttagtccctgtaaa |
19465679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 403
Target Start/End: Complemental strand, 22540273 - 22540236
Alignment:
| Q |
366 |
gtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
22540273 |
gtccatgtaaatatgcctcgttttggttttagttcctg |
22540236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 38186762 - 38186709
Alignment:
| Q |
347 |
aggctaaaatatggttttag-tccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| |||| | |||||| ||||||| |||||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 46648442 - 46648471
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46648442 |
aggctaaaatatggttttagtccctgtaaa |
46648471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 48358822 - 48358851
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48358822 |
aggctaaaatatggttttagtccctgtaaa |
48358851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 354 - 394
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
354 |
aatatggttttagtccctgtaaatatgcctcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 24717227 - 24717283
Alignment:
| Q |
348 |
ggctaaaatatggttttag-tccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
24717227 |
ggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctg |
24717283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 395
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||| |||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 376
Target Start/End: Complemental strand, 43059001 - 43058973
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43059001 |
ggctaaaatatggttttagtccctgtaaa |
43058973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 181)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 7814245 - 7814303
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 16900207 - 16900149
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 16993598 - 16993540
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 19184152 - 19184094
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 26814230 - 26814172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 37271738 - 37271796
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 37272103 - 37272045
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37272045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 38980254 - 38980196
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
38980196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24483892 - 24483836
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 33732861 - 33732917
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33732917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 43788855 - 43788915
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
43788855 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
43788915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 11788419 - 11788361
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11788419 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 16523328 - 16523270
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16523328 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 17541381 - 17541439
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 19183781 - 19183839
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
19183839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 40302342 - 40302284
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40302342 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 44073808 - 44073750
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
44073750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 5790558 - 5790615
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 9195208 - 9195151
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 22881612 - 22881665
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 24358614 - 24358671
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 25705451 - 25705394
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 26813866 - 26813923
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 43592044 - 43592101
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 43597152 - 43597209
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 44985623 - 44985676
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44985676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 2481558 - 2481502
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 4423894 - 4423950
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 8046328 - 8046384
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 11713846 - 11713790
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
11713790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 14003743 - 14003687
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 15842824 - 15842768
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 16522990 - 16523046
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 27311071 - 27311015
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 29859873 - 29859817
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 38731828 - 38731884
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38731884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 3671192 - 3671137
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 8046648 - 8046593
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 10671944 - 10671889
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
10671944 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 11713485 - 11713540
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 403
Target Start/End: Complemental strand, 29865515 - 29865456
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
29865515 |
gataggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctg |
29865456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 36622250 - 36622305
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 38639410 - 38639469
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt |
38639469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 336 - 403
Target Start/End: Original strand, 41451825 - 41451892
Alignment:
| Q |
336 |
ttattttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
41451825 |
ttatttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 41694003 - 41693948
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 3838263 - 3838209
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
3838209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 43789193 - 43789135
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggt |
43789135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 44559059 - 44559117
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44559059 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 3671001 - 3671058
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 7814739 - 7814682
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7814739 |
taggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
7814682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 13215058 - 13215115
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 14003407 - 14003464
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 15842459 - 15842516
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15842459 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 16673773 - 16673716
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 20131315 - 20131372
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 20658059 - 20658116
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20658116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 23989836 - 23989889
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 26239162 - 26239105
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 44985986 - 44985929
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44985986 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 4424186 - 4424130
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 18113088 - 18113144
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 24358946 - 24358890
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 25705084 - 25705140
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 27310875 - 27310930
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg |
27310930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 30215421 - 30215477
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 33576118 - 33576062
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 40301974 - 40302030
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctg |
40302030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 41693673 - 41693729
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 43671933 - 43671989
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
43671933 |
aggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 1497610 - 1497665
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 9195054 - 9195109
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 10375069 - 10375014
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg |
10375014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 12835325 - 12835380
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 31226077 - 31226022
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg |
31226022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 34317798 - 34317853
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 17541777 - 17541719
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
17541719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 17912808 - 17912754
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggt |
17912754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 24483401 - 24483455
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg |
24483455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 26707870 - 26707928
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
26707870 |
ataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg |
26707928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 402
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 32691310 - 32691368
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
32691310 |
ataggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg |
32691368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 348 - 402
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 4042609 - 4042662
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 10664982 - 10665039
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| | |||||||||| |
|
|
| T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctg |
10665039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 10671628 - 10671685
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 33575750 - 33575807
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 40786458 - 40786515
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| || ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 2265398 - 2265342
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 3837932 - 3837988
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 16673410 - 16673466
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 17302144 - 17302088
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 26238816 - 26238868
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26238868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 31225714 - 31225770
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 31326253 - 31326197
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg |
31326197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 31644840 - 31644892
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 32476094 - 32476150
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 37911121 - 37911065
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 43597500 - 43597444
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
43597444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 43710709 - 43710653
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 146690 - 146635
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 17912447 - 17912506
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggt |
17912506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 31325920 - 31325975
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 36806892 - 36806841
Alignment:
| Q |
352 |
aaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 40124966 - 40125021
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 400
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 338 - 400
Target Start/End: Complemental strand, 4042900 - 4042838
Alignment:
| Q |
338 |
attttggataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||| ||| |||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4042900 |
attttagattggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 30215874 - 30215816
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
30215874 |
ataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 354 - 400
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
354 |
aatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 36815485 - 36815543
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
36815485 |
ataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctg |
36815543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 38979889 - 38979947
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatat-gcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 1138361 - 1138304
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 3172019 - 3172072
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 3172533 - 3172480
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13802485 - 13802534
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
13802485 |
aggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 25954114 - 25954167
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 31909480 - 31909428
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 398
Target Start/End: Complemental strand, 35686341 - 35686288
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
35686341 |
ataggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 350 - 399
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 45442697 - 45442644
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2481192 - 2481248
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || | || ||||||| |||||||||||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 10665295 - 10665239
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||||||| |||||||||||||||| |||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 23732329 - 23732274
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg |
23732274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 35155620 - 35155564
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 36815836 - 36815780
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 37228732 - 37228784
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 40125290 - 40125234
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 44994062 - 44994010
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||| ||||||||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 14392785 - 14392836
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
14392785 |
ataggttaaaatatggttttagtcattgtaaatatgcctcgttttagtttta |
14392836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 18113454 - 18113399
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 34964159 - 34964104
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||| ||||||| ||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 3832640 - 3832586
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3832640 |
ataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 349 - 402
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||| | |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 13215367 - 13215318
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||| ||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 19604978 - 19604921
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||| |||||| ||||||||| |
|
|
| T |
19604978 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctggt |
19604921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 20658411 - 20658362
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||| |||| |
|
|
| T |
20658411 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||||||| |||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 37910754 - 37910811
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||| |||| ||||||||||||| |
|
|
| T |
37910754 |
taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg |
37910811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| || |||| |||||||| ||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 43672319 - 43672263
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 396
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 396
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 43710384 - 43710435
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
353 |
aaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 13850519 - 13850577
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||| || ||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
13850519 |
ataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctg |
13850577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 347 - 389
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgtttt |
389 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 358 - 404
Target Start/End: Complemental strand, 33576076 - 33576030
Alignment:
| Q |
358 |
tggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
404 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||| |||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctgg |
33576030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 1295181 - 1295234
Alignment:
| Q |
347 |
aggctaaa-atatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||| ||||| |||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
1295181 |
aggctaaatatatgattttggtccatgtaaatatgtctcgttttggttttagtc |
1295234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 14393129 - 14393077
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| ||| ||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 403
Target Start/End: Complemental strand, 22881950 - 22881913
Alignment:
| Q |
366 |
gtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
22881913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 38732135 - 38732078
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| |||||| || |||||||||| | ||||||| ||||||||||||||| |||||| |
|
|
| T |
38732135 |
taggttaaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctg |
38732078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 43592381 - 43592328
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||| ||||| ||||||||| |
|
|
| T |
43592381 |
aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc |
43592328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||| |||||| || ||||||| ||||||||||||||| |||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg |
44993858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 1295544 - 1295492
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| | |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg |
1295492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 7121308 - 7121257
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || |||| |||||||||| |
|
|
| T |
7121308 |
ggctaaaatatggttttagt-cctgtaaatatgtttcattttagttttagtcc |
7121257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 39367761 - 39367709
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| | |||||||||||||| |
|
|
| T |
39367761 |
aggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtc |
39367709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 54; Significance: 9e-22; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 14695 - 14752
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 15013 - 14957
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 2777 - 2833
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 53; Significance: 4e-21; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 366274 - 366218
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
366218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 365979 - 366034
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 9028 - 8973
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 51; Significance: 6e-20; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 1310 - 1368
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 1645 - 1587
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 51; Significance: 6e-20; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 8546 - 8604
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 51; Significance: 6e-20; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 290 - 232
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 51; Significance: 6e-20; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 82709 - 82651
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
82709 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 82340 - 82396
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 34931 - 34988
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 75766 - 75709
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
75766 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 75357 - 75414
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 5208 - 5264
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 5228 - 5284
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 49; Significance: 9e-19; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 3919 - 3863
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 9e-19; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 54814 - 54870
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 4039 - 4098
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
4098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 19221 - 19280
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
19280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 4289 - 4231
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
4231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 19471 - 19413
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
19413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 12182 - 12237
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
12237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 403
Target Start/End: Original strand, 94053 - 94112
Alignment:
| Q |
344 |
gataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
94053 |
gataggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 24369 - 24427
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24369 |
ataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 5398 - 5456
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
5456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 5709 - 5651
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
5651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 3293 - 3236
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
3236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 27366 - 27309
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
27366 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 361 - 403
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
361 |
ttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 18045 - 17988
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 376
Target Start/End: Original strand, 17713 - 17741
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17713 |
ggctaaaatatggttttagtccctgtaaa |
17741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 2662 - 2606
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 2331 - 2382
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||| ||| |||||||||||| |
|
|
| T |
2331 |
ataggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 355 - 403
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
355 |
atatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 10518 - 10460
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||| |||| |
|
|
| T |
10518 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 47924 - 47980
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
351 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 223174 - 223120
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
223174 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 17966 - 17911
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 403
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 147889 - 147941
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
147889 |
aggctaaaatatggtttt-gtccctgcaaatat--ctcgttttagttttagtccct |
147941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Original strand, 8329 - 8382
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 8643 - 8590
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 3749 - 3807
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| | |||||||||||| |||||| |
|
|
| T |
3749 |
ataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 4082 - 4028
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
399 |
Q |
| |
|
||||||||||||| |||||| ||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
4082 |
ataggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 400
Target Start/End: Complemental strand, 22056 - 22003
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
400 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 38; Significance: 0.000000000003; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 189326 - 189379
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
189326 |
ataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 189679 - 189630
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| ||| ||| ||||||||||| ||||||||||| |
|
|
| T |
189679 |
aggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 61631 - 61687
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||| || ||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
61631 |
aggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 402
Target Start/End: Original strand, 2498 - 2555
Alignment:
| Q |
345 |
ataggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
2498 |
ataggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct |
402 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 16724 - 16779
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagt |
398 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 34; Significance: 0.0000000008; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 35086 - 35029
Alignment:
| Q |
346 |
taggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
403 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 367 - 405
Target Start/End: Complemental strand, 35006 - 34968
Alignment:
| Q |
367 |
tccctgtaaatatgcctcgttttggttttagtccctggt |
405 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35006 |
tccctgtaaatatgtctcgttttggttttggtccctggt |
34968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University