View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_117 (Length: 347)
Name: NF7850A_low_117
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_117 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 49 - 346
Target Start/End: Complemental strand, 33507199 - 33506902
Alignment:
| Q |
49 |
attatgtccaatgccaattactgagtaaaatcattttactcgtgagtggttgatgctaatgcttgatttcaggatcgttgaccgaaatatccaagggtgc |
148 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507199 |
attatgtccaatgccaattactgaataaaatcattttactcgtgagtggttgatgctaatgcttgatttcaggatcgttgaccgaaatatccaagggtgc |
33507100 |
T |
|
| Q |
149 |
tgtgggaaaactgctacgtcgtgctaacaaaggtggcaattctaagaaaaagaccacggttagttccctgtaactccccgttgcttttacataatttgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507099 |
tgtgggaaaactgctacgtcgtgctaacaaaggtggcacttctaagaaaaagaccacggttagttccctgtaactccccgttgcttttacataatttgtt |
33507000 |
T |
|
| Q |
249 |
ctgttcagctcttatcgtgaatttgttacataattttacttcattgttagcttttgaaatcatataaccatggccaaaatcaagttcttctgatcttg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33506999 |
ctgttcagctcttatcgtgaatttgttacataattttacttcattgttagcttttgaaatcatataaccatggccaaaatcaagttcttctgatcttg |
33506902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University