View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_126 (Length: 343)
Name: NF7850A_low_126
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_126 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 19 - 134
Target Start/End: Original strand, 1972326 - 1972441
Alignment:
| Q |
19 |
gtggttacatccctatcgttctattttgaattcccattttgaaaatttcctttgctttatgttgttcaattcatctttcatatgtaagcctcttggtggt |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1972326 |
gtggttacatctctatcgttctattttgaattcccattttaaaaatttcctttgctttatgttgttctattcatctttcatatgtaagcctcttggtggt |
1972425 |
T |
|
| Q |
119 |
tagtagaggaatattg |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1972426 |
tagtagaggaatattg |
1972441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University