View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_132 (Length: 339)
Name: NF7850A_low_132
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_132 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 115 - 334
Target Start/End: Complemental strand, 44999350 - 44999135
Alignment:
| Q |
115 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacatttctttattta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44999350 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacattt----attta |
44999255 |
T |
 |
| Q |
215 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999254 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
44999155 |
T |
 |
| Q |
315 |
gtgtgcctctctatgatact |
334 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44999154 |
gtgtgcctctctatgatact |
44999135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University