View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_136 (Length: 337)
Name: NF7850A_low_136
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_136 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 56 - 330
Target Start/End: Complemental strand, 44450587 - 44450317
Alignment:
| Q |
56 |
gtcgtcagtcgaactttannnnnnnaatgaatcgtcacactgacagcatccaaaaattaaaataattgtttgttcactttcatttaaagagttgattttt |
155 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44450587 |
gtcgtcagtcgaactttatttttttaatgaatcgtcacactgacaacatccaaaaattaaaataattgtttgttcactttcatttaaagagttgattttt |
44450488 |
T |
|
| Q |
156 |
agttccacctcacagcgtgtgatgtaataacaatgaataattaatctatttcatgcattattgacaaatgtgatagaggaaggaaataatgattatcgat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| | |
|
|
| T |
44450487 |
agttccacctcacagcgtgtgatgtaataacaatgaataattaatctatttcatgcattattgacaaatgtgat----ggaggaaataatgattatcggt |
44450392 |
T |
|
| Q |
256 |
atatctttaagtatcgagataaaattgtattgannnnnnnnatgtttttgttcaacttaatttgttatttctttg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44450391 |
atatctttaagtatcgagataaaattgtattgattttttttatgtttttgttcaacttaatttgttatttctttg |
44450317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University