View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_157 (Length: 316)
Name: NF7850A_low_157
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_157 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 107 - 306
Target Start/End: Complemental strand, 25933416 - 25933214
Alignment:
| Q |
107 |
ttgtatgttaaattaatcatttttcaagaacaaacc---attattgtgttttgatgttaactttctgatttttagagaaagggcgttcaacttagtttaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25933416 |
ttgtatgttaaattaatcatttttcaagaacaaaccgtaattattgtattttgatgttaactttctgattttcagagaaagggcgttcaacttagtttaa |
25933317 |
T |
 |
| Q |
204 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatttattgagatgcttagtcacaaaacatttaaattaaagttctatat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933316 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatttattgagatgcttagtcacaaaacatttaaattaaagttctatat |
25933217 |
T |
 |
| Q |
304 |
tct |
306 |
Q |
| |
|
||| |
|
|
| T |
25933216 |
tct |
25933214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University