View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_159 (Length: 315)
Name: NF7850A_low_159
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_159 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 292
Target Start/End: Original strand, 12682907 - 12683180
Alignment:
| Q |
19 |
caaccccagtaccgttgccagcagtagcagcaccactgccgataccgataccagcaatacctacaccgcagcaagttcaaaatccaactgtaacagtgca |
118 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682907 |
caacaccagtaccgttgccagcagcagcagcaccattgccaataccgataccagcaatacctacaccgcagcaagttcaaaatccaactgtaacagtgca |
12683006 |
T |
|
| Q |
119 |
acaacaaacatcagtcattcctcaggcttcaccattgccacaacatcagcagcagcaacagcaggttcaggtacaacagcagcaagtgacgaatatggaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12683007 |
acaacaaacatcagtcattcctcaggcttcaccgttgccacaacatcagcagcagcaacagcaggttcaggtacaacagcagcaagtgatgaatatggaa |
12683106 |
T |
|
| Q |
219 |
gttgcgaaaagtgataacaatggtgagagtatgatgcatgcaagttcttctaggtggccaaaaactgaggttga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683107 |
gttgcgaaaagtgataacaatggtgagagtatgatgcatgcaagttcttctaggtggccaaaaactgaggttga |
12683180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University