View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_177 (Length: 303)
Name: NF7850A_low_177
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_177 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 289
Target Start/End: Complemental strand, 7766780 - 7766499
Alignment:
| Q |
7 |
cttttgatgaaaaagaatgagaaggttagggtttcgaagaggttttgataggttttagaagatttagttcaaagaatcagaaggttagggttagggtttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7766780 |
cttttgatgaaaaagaatgagaaggttagggtttcgaagaggttttgataggttttagaagatttagttcaaagaatcggaaggttagggttagggtttt |
7766681 |
T |
|
| Q |
107 |
gaagagatgaatttattgagtgaaaaatttgataggttttgtttaaacaacaagagaagaaagggaatcagggttttggtatgttttaaggaagagggaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7766680 |
gaagagatgaatttattgagtgaaaaatttgataggttttgtttaaacaacaagagaagaaagggaattagggttttggtatgttttaaagaagagggaa |
7766581 |
T |
|
| Q |
207 |
agatgaaaaaggttcaaaactcagaaagaattttgcaccgaaataagaatctcaactgtaaattgcatcgcacgctttttatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7766580 |
agatgaaaaa-gttcaaaactcagaaagaattttgcaccgaaataagaatctcaactgtaaattgcatcgcacgctttctatt |
7766499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 95 - 227
Target Start/End: Complemental strand, 7777374 - 7777241
Alignment:
| Q |
95 |
ggttagggttttgaagagatgaatttattgagtgaaaaatttgataggttttgtttaaacaacaagagaagaaagggaatcagggttttggtatg-tttt |
193 |
Q |
| |
|
||||||||||| |||||| |||| || || |||||||| ||||||||||||| |||||| || |||||||||||| ||| ||||||||| ||| | |
|
|
| T |
7777374 |
ggttagggtttcgaagaggtgaaattcttaagtgaaaattttgataggttttatttaaataatgagagaagaaaggtaattagggttttgagatgatgaa |
7777275 |
T |
|
| Q |
194 |
aaggaagagggaaagatgaaaaaggttcaaaact |
227 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
7777274 |
aaagaagagggaaagatgaaaaaggttcaaaact |
7777241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 7777389 - 7777355
Alignment:
| Q |
15 |
gaaaaagaatgagaaggttagggtttcgaagaggt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7777389 |
gaaaaagaatgagaaggttagggtttcgaagaggt |
7777355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University