View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_196 (Length: 293)
Name: NF7850A_low_196
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_196 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 32346603 - 32346325
Alignment:
| Q |
10 |
agatgaaactgtgagacacttgattcgtcataaactttatcatatgtttaataaatatcttggacatatgcttgtttaccaatatattagatgctttttt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32346603 |
agatggaactgtgagacacttgattcgtcataaactctatcatatgtttaataaatatcttggacatatgcttgtttaccaatatgttagatgctttttt |
32346504 |
T |
 |
| Q |
110 |
-gtagtaccgaagattagagctacggataatgctttcattcactatgctttacagagctgattctttgacaagatgaatgcttctaaatttactttttct |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32346503 |
tgtagtaccgaagattagagctacagataatgctttcattcactatgctttccagagctgattctttgacaagatgaatgcttctaaatttacttttcct |
32346404 |
T |
 |
| Q |
209 |
aactaattttgtatgctgactagaattgattatatagtgtcttttacttcttgttgtgttctactagctggataaagat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346403 |
aactaattttgtatgctgactagaattgattatatagtgtcttttacttcttgttgtgttctactagctggataaagat |
32346325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University