View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_217 (Length: 283)
Name: NF7850A_low_217
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_217 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 23853420 - 23853153
Alignment:
| Q |
16 |
ggacatcaacatagataccaattaactagagttcaattacatagagactcaattgtgtttgaatataaggtgtccccaaatataaataagtgctcaagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853420 |
ggacatcaacatagataccaattaactagagttcaattacatagagactcaattgtgtttgaatataaggtgtccccaaatataaataagtgctcaagat |
23853321 |
T |
|
| Q |
116 |
atgcacggaaatagaacatcaacatgactcgttccaaatataaaaatgaacaaatgaaaggacataataaaatgagatgcctatttaagttgtgttggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853320 |
atgcacggaaatagaacatcaacatgactcgttccaaatataaaaatgaacaaatgaaaggacataataaaatgagatgcctatttaagttgtgttggtt |
23853221 |
T |
|
| Q |
216 |
gtgtcacggttgtgttgtgcccacccgacttgcagctctgcttcagtctcttcccttaaatatggata |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853220 |
gtgtcacggttgtgttgtgcccacccgacttgcagctctgcttcagtctcttcccttaaatatggata |
23853153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University