View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_231 (Length: 274)
Name: NF7850A_low_231
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_231 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 37217416 - 37217177
Alignment:
| Q |
19 |
agtacagtcccaaaactgaaaatccagatttcagtcccttcattcatttgagacacccgaccttatttctcaagtatactcacacttttccccttgttga |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217416 |
agtactgtcccaaaactgaaaatccagatttcagtcccttcattcatttgagacacccgaccttatttctcaagtatactcacacttttccccttgttga |
37217317 |
T |
 |
| Q |
119 |
atatgtacttggaatcttatcatagatggtttgaaggagaaaatcagaagggtagcaaaagtactagaacttccaaaagccacttaaatcatttccaaga |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217316 |
atatgtacttggaaccttatcatagatggtttgaaggagaaaatcagaagtgtagcaaaagtactagaacttccaaaagccacttaaatcatttccaaga |
37217217 |
T |
 |
| Q |
219 |
taacgaggtaaatatgcgttctcttaagaggacttgatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217216 |
taacgaggtaaatatgcgttctcttaagaggacttgatgt |
37217177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University