View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_253 (Length: 266)
Name: NF7850A_low_253
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_253 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 266
Target Start/End: Complemental strand, 7432858 - 7432618
Alignment:
| Q |
11 |
ttattcttgatttttaacggttaaagtcttctcaatttgccaagatcccgcttgcaaacgacaagataactttcaagttgtaagaaaaataagcttggac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432858 |
ttattcttgatttttaacggttaaagtcttctcaatttgccaagatcccgcttgcaaacgacaagataactttcaagttgtaagaaaaataag------- |
7432766 |
T |
 |
| Q |
111 |
gggataagttgaacctaattaagtttaaattttacttttaaattaatcattgattgaacctatttctttaaatagtaaaacaagttgaagtttaataact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432765 |
--------ttgaacctaattaagtttaaattttacttttaaattaatcattgattgaacctatttctttaaatagtaaaacaagttgaagtttaataact |
7432674 |
T |
 |
| Q |
211 |
aagcaagcttaaacaagagtttgcttgattatagagagttgtattttttgtccgca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
7432673 |
aagcaagcttaaacaagagtttgcttgattatagagaggtgtatttttcgtccgca |
7432618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University