View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_265 (Length: 262)
Name: NF7850A_low_265
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_265 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 40483191 - 40483445
Alignment:
| Q |
8 |
aaattatactttgaagcttcaatgaaatcatggtgtcaccgtgatttgacaaaattcactatcaatccaaacatgcacttagctcctgaaattgagttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40483191 |
aaattatactttgaagcttcaatgaaatcatggtgtcaccgtgatttgacaaaattcactatcaatccaaacatgcacttagctcctgaaattgagttgt |
40483290 |
T |
|
| Q |
108 |
gtaacaaattaacaattgcatatgttgcaggtgtgtgctttgccgcaaaagagctgattatcttgtatccaagaaggtaatgttttctgctcttcttata |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
40483291 |
gtaacaaactaacaattgcatatgttgcaggtgtgtgctttgccgcaaaagagctgattatcttgcatccaagaaggtattgttttctgctcttcttata |
40483390 |
T |
|
| Q |
208 |
ctgtcttctgaaatttcatttgattcttgctagcttcaacctcatattaagattg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40483391 |
ctgtcttctgaaatttcatttgattcttgctagcttctaactcatattaagattg |
40483445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 61
Target Start/End: Original strand, 22533728 - 22533761
Alignment:
| Q |
28 |
aatgaaatcatggtgtcaccgtgatttgacaaaa |
61 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
22533728 |
aatgaaatcatggtctcaccgtgatttgacaaaa |
22533761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University