View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_268 (Length: 261)
Name: NF7850A_low_268
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_268 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 251
Target Start/End: Original strand, 43410758 - 43411010
Alignment:
| Q |
6 |
acagatatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410758 |
acagatatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcaca |
43410857 |
T |
|
| Q |
106 |
catcatctcacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410858 |
catcatctcacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctc |
43410957 |
T |
|
| Q |
206 |
----ctagctagcttacaacttc---tcatctgaatgtgttgtgtctgtctgt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43410958 |
ctagctagctagcttacaacttctgatcatctgaatgtgttgtgtctgtctgt |
43411010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University