View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_279 (Length: 257)
Name: NF7850A_low_279
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_279 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 3 - 251
Target Start/End: Complemental strand, 11370146 - 11369898
Alignment:
| Q |
3 |
aaacatagaggacaaaaactccatgcccaactgacccgacagctacatataaaataaaacaacacctaatttgcaaaactcaagtgttactggtacaccc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11370146 |
aaacatagaggacaaaaactccatgcccaacagacccgacggctacatataaaataaaacaacacctaatttgcaaaactcaagtggtactggtacaccc |
11370047 |
T |
 |
| Q |
103 |
gttttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcattacagcaacaaacact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11370046 |
gttttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcattacagcaacaaacact |
11369947 |
T |
 |
| Q |
203 |
catatacaatcattaattcttgcattgcagccacttaaactgagcaaag |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369946 |
catacacaatcattaattcttgcattgcagccacttaaactgagcaaag |
11369898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University