View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_287 (Length: 254)
Name: NF7850A_low_287
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_287 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 26 - 239
Target Start/End: Original strand, 49166171 - 49166384
Alignment:
| Q |
26 |
attatgcgaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaagatagttcataggtttg |
125 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49166171 |
attatgcaaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaagatagttcataggtttg |
49166270 |
T |
|
| Q |
126 |
aatacttttggctacaggttcacaatacctactttttccaaatactagtatgcattatgttgcttgtatattcagtttattttctatttaggcttgttac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
49166271 |
aatacttttggctacaggttcacaatacctacattttccaaatactagtatgcattatgttgcttgtatattcagtttattttctatttactcttgtgac |
49166370 |
T |
|
| Q |
226 |
attgttatattctt |
239 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
49166371 |
attgttattttctt |
49166384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University