View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_290 (Length: 253)
Name: NF7850A_low_290
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_290 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 103 - 231
Target Start/End: Original strand, 5783284 - 5783412
Alignment:
| Q |
103 |
atgacataaataaatttggaggatttaaatctgagtaattatgaggtctcagtttcgatattgaggaggaggttgatgaatcgtaacatgatcccaaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5783284 |
atgacataaataaatttggaggatttaaatttaagtgatgatgaggtctcagtttcgatattgaggaggaggttgatgaatcgtaacatgatcccaaatt |
5783383 |
T |
 |
| Q |
203 |
gtgtttggtgggttggttcttgaccgatc |
231 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
5783384 |
gtgtttggtgggtaggttcttgaccgatc |
5783412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University