View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_291 (Length: 251)
Name: NF7850A_low_291
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_291 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 23341155 - 23340906
Alignment:
| Q |
1 |
tttggtcttcgataaccttagtcttcgaaattgactcatatagcagttagaaaatcgttcagtttca------taaaaaattgttaatttgttcctttca |
94 |
Q |
| |
|
|||| ||||| |||||||||| |||| ||||||||||||||||||| |||||||| ||||||||||| ||||||| | ||||||||||| ||||| |
|
|
| T |
23341155 |
tttgttcttctataaccttaggcttcaaaattgactcatatagcaggtagaaaattgttcagtttcactttcataaaaaaatcttaatttgttcatttca |
23341056 |
T |
 |
| Q |
95 |
attatgttgattgtttgattaagttctaatttgtttgacttatgcttcatttttctcgatcaggtcgaacttccactttatctattcacctggctcacac |
194 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23341055 |
attatgttgattgttagattaagttctaatttgtttgacttatgcttcatttttctcgatcaggtcgaacttccactttttctattcacctggctcacac |
23340956 |
T |
 |
| Q |
195 |
tatacctgcatatgttcaagcagcgtggttcgaaactttctgaacaccat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23340955 |
tatacctgcatatgttcaagcagcgtggttcgaaactttctgaacaccat |
23340906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 22439888 - 22439822
Alignment:
| Q |
1 |
tttggtcttcgataaccttagtcttcgaaattgactcatatagcagttagaaaatcgttcagtttca |
67 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||| | |||||||||| |||||| ||||||||||||| |
|
|
| T |
22439888 |
tttggtcttcaataagcttagtcttggaaatcggctcatatagcgcgtagaaattcgttcagtttca |
22439822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University