View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_316 (Length: 249)
Name: NF7850A_low_316
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_316 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 40 - 153
Target Start/End: Original strand, 4324334 - 4324447
Alignment:
| Q |
40 |
ctgtcagggattccaccacagttgatttattgaataattgtaaatttattcaatcaacttaaaaaagtgaatttatctttagttgaacaagaaagttcaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324334 |
ctgtcagggattccaccacagttgatttattgaataattgtaaatttattcaatcaacttaaaaaagtgaatttatctttagttgaacaagaaagttcaa |
4324433 |
T |
|
| Q |
140 |
ctcaaaaatgacaa |
153 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4324434 |
ctcaaaaatgacaa |
4324447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 6 - 40
Target Start/End: Original strand, 4324252 - 4324286
Alignment:
| Q |
6 |
tatggagttgggaagtgctctgttcaaagacttgc |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324252 |
tatggagttgggaagtgctctgttcaaagacttgc |
4324286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University