View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_317 (Length: 249)
Name: NF7850A_low_317
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_317 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 22 - 237
Target Start/End: Original strand, 49673172 - 49673377
Alignment:
| Q |
22 |
aagtcaacttgcgtattaggtggttcaatacggggatatattgtggaagttaaagagtgaactacaacacactttcattagtgaatcacattacaatctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673172 |
aagtcaacttgcgtattaggtggttcaatacggggatatattgtggaagttaaagagtgaagtacaacacactttcattagtgaatcacattacaatctc |
49673271 |
T |
 |
| Q |
122 |
tacctataaagtgggggattttcttgaaacttgttgcttattttccaccactgtttccgtatcttggctttgcaatacacaatgaacccccttttcattt |
221 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49673272 |
tacctataaagtgggggattttc----------ttgcttattttccaccactgtttccgtatcttggccttgcaatacacaatgaacccccttttcattt |
49673361 |
T |
 |
| Q |
222 |
tcaaatcattaatatt |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49673362 |
tcaaatcattaatatt |
49673377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University