View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_319 (Length: 249)
Name: NF7850A_low_319
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_319 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 41103134 - 41103375
Alignment:
| Q |
1 |
gtttcaccgagtctaacctgtgaagcaacgacttgcgatctgatcggtgagtttgaatccggcgaaaaaattgattcaatttgattccaattttctgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103134 |
gtttcaccgagtctaacctgtgaagcaacgacttgcgatctgatcggtgagtttgattccgacgaaaaaattgattcaatttgattccaattttctgaaa |
41103233 |
T |
 |
| Q |
101 |
tcgcttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgccacgttttccgggaatgcaaacagcagcagtgcgctttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
41103234 |
tcgcttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgccacgttttccgggaatgcaaacagcattaatgcgctttctct |
41103333 |
T |
 |
| Q |
201 |
gcaaatatcagcgaaacacgattctccgatgttgttcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41103334 |
gcaaatatcagcgaaacacgattctccgatgttgttcttctc |
41103375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 158
Target Start/End: Original strand, 23129044 - 23129108
Alignment:
| Q |
94 |
tctgaaatcgcttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgc |
158 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23129044 |
tctgaaattgcttcgtataaatcaagagttctgaacattttctcaggagttttcttgcattttgc |
23129108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University