View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_328 (Length: 248)
Name: NF7850A_low_328
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_328 |
 | |
|
| [»] scaffold0405 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 4 - 226
Target Start/End: Original strand, 19963570 - 19963790
Alignment:
| Q |
4 |
ttcttacatgtgataaaatgtatgaagtacggttcaaacctgttgtgaaggcagccattagagagatttcaaaacaggagaaatgggaatgtgatgcttt |
103 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| || |
|
|
| T |
19963570 |
ttctgacatgtgacaaaatgtatgaagtacggttcaaacctgttgtgaaggcagccattagagatatttcaaaacaggagaaataggaatgtgatgc-tt |
19963668 |
T |
|
| Q |
104 |
tggcagtgtccaatttagtatcatttacagacattcacnnnnnnnnagttctacaagtcattcactttgatgaatgctactttgcatattaactgtttga |
203 |
Q |
| |
|
|||||||| |||||||||||||||||| || ||||||| ||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
19963669 |
tggcagtgcccaatttagtatcatttatagtcattcac-ttttgttagtactacaagtcattcacttcgatgaatgctactttgcattttaactgtttga |
19963767 |
T |
|
| Q |
204 |
taaaaggatcattagaacttagt |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19963768 |
caaaaggatcattagaacttagt |
19963790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 22 - 132
Target Start/End: Complemental strand, 19910461 - 19910352
Alignment:
| Q |
22 |
tgtatgaagtacggttcaaacctgttgtgaaggcagccattagagagatttcaaaacaggagaaatgggaatgtgatgcttttggcagtgtccaatttag |
121 |
Q |
| |
|
|||||||||||| | ||||||||| |||| |||||||||||||||||||||||| |||||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
19910461 |
tgtatgaagtacaggccaaacctgtgtggaagacagccattagagagatttcaaaacgggagaaatggaaatgcaatg-ttttggcagtgtccaatttag |
19910363 |
T |
|
| Q |
122 |
tatcatttaca |
132 |
Q |
| |
|
|||||| |||| |
|
|
| T |
19910362 |
tatcatctaca |
19910352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 176 - 229
Target Start/End: Complemental strand, 1661542 - 1661489
Alignment:
| Q |
176 |
aatgctactttgcatattaactgtttgataaaaggatcattagaacttagttga |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1661542 |
aatgctactttgcattctaactgtttgataaaaggatcattaaaacttagttga |
1661489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 153 - 229
Target Start/End: Complemental strand, 19910357 - 19910278
Alignment:
| Q |
153 |
tctacaagtcattcactttgatgaatgcta--ctttgcatat-taactgtttgataaaaggatcattagaacttagttga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| | ||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
19910357 |
tctacaagtcattcactttgatgaatgctattttttgcatttataattgtatgataaaaggatcacgagaacttagttga |
19910278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 155 - 229
Target Start/End: Original strand, 25490145 - 25490219
Alignment:
| Q |
155 |
tacaagtcattcactttgatgaatgctactttgcatattaactgtttgataaaaggatcattagaacttagttga |
229 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
25490145 |
tacaagtcattcactttgatgaaagctactttgcattataaccgtttgataaaaggatcactagaactaagttga |
25490219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 13426 - 13356
Alignment:
| Q |
159 |
agtcattcactttgatgaatgctactttgcatattaactgtttgataaaaggatcattagaacttagttga |
229 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| |||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
13426 |
agtcgttcactttgatgagtgctactttgccgtctaactgtttgataaaatgatctctagaacttggttga |
13356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University