View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_329 (Length: 248)
Name: NF7850A_low_329
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_329 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 233
Target Start/End: Complemental strand, 45929716 - 45929488
Alignment:
| Q |
5 |
agaaacaaagagtagaaaactgcttgctcaaaaagataggacaattttttatctcacagcagaaggacaagagcactattatgagtgaagcattggcata |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929716 |
agaaataaagagtagaaaactgcttgctcaaaaagataggactattttttatctcacagcagaaggacaagagcactattatgagtgaagcattggcata |
45929617 |
T |
 |
| Q |
105 |
aaataaatacatatcatatcaccaattcagacaagtgtgttttccatgacctaacctcaaacatacgattgtactttccatcccggtttctcattctcaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45929616 |
aaataaatacatatcatatcaccaattcagacaagtgtgttttcaatgacctaacctcaaacataagattgtactttccatcccggtttctcattctcaa |
45929517 |
T |
 |
| Q |
205 |
atatgattgacatgcttcagggtcttctc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45929516 |
atatgattgacatgcttcagggtcttctc |
45929488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University