View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_334 (Length: 247)
Name: NF7850A_low_334
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_334 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 2294955 - 2294715
Alignment:
| Q |
1 |
gatgttaaggtagtttaggacaaactccattttttggttgattaatgtggtgctgaaaggaccaatgccatgcttgcttttataaggatttgtg--agtc |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||| |||| |
|
|
| T |
2294955 |
gatgttaaggtagtttaggactaactccattttttggttgattattgtggtgctgaaaggaccaataccatacttgcttttataaggatttgtgtgagtc |
2294856 |
T |
|
| Q |
99 |
atgcattatttgccatttttgttgaaagaagagtcaaacggtggcttactgtaggaagaagagccaaaacatgtcagagtattattggattctttctcct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2294855 |
atgcattatttgccatttttgttgaaagaagagtcaaacggtggcttactgtaggaagaagagccaaaacatgtcagagtattattggattctttctcct |
2294756 |
T |
|
| Q |
199 |
tcaataataggcaataaagttacttgatgtgcaagaataat |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
2294755 |
tcaataataggcaatgaagttacttgatgtgcaaggataat |
2294715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University