View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_335 (Length: 247)
Name: NF7850A_low_335
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_335 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 41405266 - 41405337
Alignment:
| Q |
11 |
catagaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggccggc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41405266 |
catagaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggccggc |
41405337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 41405396 - 41405475
Alignment:
| Q |
159 |
ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatcactacatgactcaatactatcatgttaagag |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41405396 |
ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatccctacatgactcaatactatcatgttcagag |
41405475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University